Description :
From Genome Similarity Track
Location :
Scaffold_59:25437- 29924
Transcript NameFunction/comments
Phyke_g2734hypothetical protein

Sequence
4487 bases(100 bases per row)
ATCCGGGTTCCGATACGGAAGTGTGTCTACGCAACCAAGGAGCACATTTCGCAACCATGTTGAGTCTAACAAGCCTGGAACATTTGCACGAGCCTGCTCT
GTTGCAAGCTTTAAGTGAACGTTTCGACAAGGACCAAATCTACACTTCAATTGGAGACATTCTGGTGTCTCTAAACCCACTGAAACCTCTACCTAAACTC
TATTCGGCAGCTCAACTGGAGAAATATAAGCATATGATGACGATAACGGAATCAGGAGAGACTTCCACAGACTCGGAGCTGCCTCCTCACGTATTTTCCA
TCGGTGGGAAGGCCTTTGGGGGTCTTTTGAAGGCGGAGAGACGTAACCAGAGCATTCTGGTTAGTGGAGAGagtggcagtggcaaaaCAGAGGCCACCAA
GTTCCTGATGCAGTTTTTAACCAGTGTAGGCACAAATCAGAGTCAAACGACAGCACAGAGAGAGGGCAGTGGAGCAGTGGAAATTGGCAAAAGGATTTTG
CAGACGAACCCAATTCTCGAATCTTTTGGCAACGCTCAGACCATCCGAAACGACAATTCCAGTCGCTTTGGCAAGTTTATCAAAATCCAGTTTGGAGACA
AGAACGAGATCGTCGGAGCGCAAATTGTCAGTTATTTGTTGGAGAAAGTGAGACTTTTGCATCAAAATCCAGAGGAGCGCAATTTTCACATATTTTATGA
GCTACTGGAGGGAGGAGATAAAGAACTGCTAGAGATTTTGGGACTGCAAAAAGGTGCAAAATATGAGCTGCTTAACTCCTACGGACCAAATTTTGGTCGG
AAGGGAGGTGTGGCAGACAAATACGCTCAGCTGTATGTACAGACTGTACGGGCATTTGAGGACACGGGAGTGAACAAACAGGAACAATTGGAGATTTTCA
AGATTTTGGCGGCGTTGCTACATTTAGGAAATGTCAGTTTTGACGATGCAACTGGAAGACAGGAAGACACCACGGTTGTCACAGAAACATCGCGATTCCA
TTTGGACAAATGTGCGGAGCTTATGGGGGTGGCTGTTACCAAATTAGAGGCGCTTCTGGTTAGCCGCGAAATTAAAGCTGGTATGGAAGTCATGGTGCTC
AAACTCAATCCGGAGCAGGCCAAAGATATCTGTCGGTCTCTGGCTAAAGCCGTCTACGGCCGCCTATTCACGTGGCTAGTGCGTCGCCTGAGTGACGAGA
TCAATTACTTCGACTCAGCGGTGTCTATCtctgatgaagacgaggattTGGCCACAATCGGCATTTTAGATATCTTTGGCTTCGAGAGCTTGAACTGCAA
CGGCTTTGAGCAGTTGTGTATCAACTACGCGAACGAACGCCTCCAGGCTCAATTCAATGAGTTCGTCTTCGTGCGAGAACAACAGATTTACATTGCTGAG
GGAATCGACTGGAGCAATATATCGCACCCGAGTAACGAAGCATGTCTGGCTCTCTTCGACGACAAGAGCAATGGTTTGTTTTCACTTTTGGACCAAGAGT
GTTTGATGCCCAAGGGATCCAATCAGGCCTTGAGCACGAAATTCTATCGGTATCATGGTGATAGCAACTCTGCAGACTCCGCAGGGCTATTACAGCAGCC
GCAGATTGCTCAAAGCAAGCTGCCTTTGCTCATGTCGTCTTTCAGCAGATACCTGCACCGAACTGAGTCACAAGAGGAACCAGTTAACCAGGACAATAAG
AAGCACCCATTCTCGGCGTCCAAGATGGAGCGCGTGAACCATCACTTTGTGGTCCATCACTTTGCTGGACGTGTCTGCTACAATGTCGAGCAATTCGTGG
AGAAGAACACGGACTCGCTCCCCACTGACGCAAGCGTGATCTTGAGCTCTTCTAACAACAAAGTGGTGGCGGCGATCGGATCAGACGAGAACGTGGACTC
ACCAAGCAATGACAATGGGACGACTGGACGACGTCGCCACTCCATGCTACGAGCGCCTAGCGTGTCAGCACAATTCAAGAGTCAGTTGGACCGCCTGATT
GTTCAGATCGGACGAACAGAGGCGCATTACGTGCGCTGTCTTAAGCCTAACGAGGTGAAAAAGCCAGGTATTTTCGATCGCGAGAGGATGGTGGAACAAA
TGCGCTCTGTCGGGGTGCTGGAGGCGGTTCGCATCGCGCGTCATGGTTACTCTGTTCGTCTCACCCATTCGAGCTTCAACGAGCTGTTCTCGAGTTTTCG
TTGCTTGCTTAGTGTGCGAGATCGAACCATTAAGATGCATGACCACGACTTGGCCCAAGCGCTAGTGAATGTATTGATGGACAAGGTACTGCTAGAAGAC
GGTGTGGAGCGTGATGGGGAAAATTCAAGTGCCCTGGCTGCAATCACGGACAACGGTAGCGGCACAGCTTTTGGGAATGATGTACGCCGGAAGGATGTAC
AGGTGGGTAAAACATTAGTGTTCTGCAAGTCCACTATTTACAACCGCTTTTCTCAGTACCGCCTGGAGCTGAGGAACAACGCCGCTGAAGTACTACAGAA
GCATTACCGTGGGTATCGCCGACGCGTGCTTTTCCGGCAGATGCGCGGCTTCGTGATGCACGTGCAGGCGATTATCCGGGGATTTCTTGGAAGGAGACAG
GTGGATAAGTTGCGCCAGTTGTGTCGCGAAACTGCAGCTACTTGTATCCAAACACAATACAGGCGCTTGGTTGCACAGCGGAAATTTTGGGAAATTCTTC
TGCAAAAGCGTAAACTAGCCGCTACCATCCGTATCCAAGTGCAATGTAGGCGTTGGTTGGCACAGCGGAAGTTTAAAGAATTGCTACTGCAAAAGCTCCA
GATTTCAGCGATGATCCGAATTCAAGCCCAGTGTCGGTGTTGGCTAGCCCAACGAAAACGCCAACAGTTGTTAAAGCTTAGACACCAGGTTTCGGCGATA
GTTCAAATTCAAGCGCAATGCAGGCGTTGGTTAGCGCAGAGGAAGCGAGAAAAATTGCTGAAGGGGAAGCTCGAGGTTGCTTCGGCTATCGTTATCCAGA
GGCAGAGTAGACGGTGGCTTCAGGAGAACCGCAACATGGTGGCAAAACTTCAGCAGTTCCGCTTGTCAGTGGCATTCAGCAAATTCCGACGTGCTTGCCT
GGAGTCGCAAACGGAGGTCGAGATGGAGCCGTCTCCGGTTCCGAGCGACGATTCGACATCAAGCCGAGCGAAACGACGTGCAGTAGCTTCGGCTGGTTCG
GCTGGTTCAGCTGGACTTCCGGCTACCCAATCCAGCTCAGAACAGGAAGACAGTTCTGCTAGTGATGGCAGAATGGAGCCTCCGATTCGCATTTCCGCTC
CCACACATCGTCGCACGCACAGCAGGCAGCGCAATCGCACGAACAGTAAGAGCCGTAGTCGCGCGAATAGCAGTCATGTTGACCACCGGAACTCTTCGCT
GGAGAACGAGATCTTgcgtttgcagcagttgctcaCGGAACAGCAAAGCAGTCGCCCACCGCGGGATCAACGGCAGCGAGCATCAACAATTTCTCGTCCA
CCGCGAAGCGCGCCACTGGATTTGTTTCATGAACAAGCATCTCGTCCACGACGTGCGAACCCGAATAATCGTCGGAGGTACTCCCTTGATGGTACTCCAt
cagacgaagatggtgagATGGATGACGAATTATCATTGCTGCCGCTGCGCCGTGCGCGTAGTGTGATGCCcggacagcagcagattgacCACGTGTCAAT
GCTTTCTCAAAAGATTGAGGAGCTCGACGCGAAGTGCAAGTTCCTGGAACAGCTCGTGGCTCGGAAGAACTATGAAGATGCGTCAAGAGAATCTCTTATG
TATGGGAGAGGGTCTATGGGCGAGCGCGAGCGTTTTCTCTCTACGGATGGGTCCCTGTACGGTGACGCTCCTCCAAGCGAGGCGGGGTCGGACGTGGACT
CGATCATCTTTAACATTCAAAGTCAGATGGACATGCTGCGGCAGTCCATTGCTGTTAAGGAGCAGGTGCTTCAGGCGTCCTGCAAGCCTCACACCACGTC
GTTCTCATCCAGCACGCGGCCGACGcgatcttcatctgcagcatccTCCACGGCGTACTCGAACCTGCCATACGGCGAGGCTCCTCCAAGCATGCCGTCA
CTGCCGCTGTCGGAATCGCAATTATCGGTAGGCGGATCGTCGCATGGCAATAGTCGTCGTAGTGGCAGCTCGCTGGGACTCCCACCCACGCCAACGTCTT
CTGTGGCCTCGTCATTCTATCAAGGGCCTTCCCGTTCGTCACCAGCGCACTTCGGCGGCCGAGGCATGCCACGTATCGTGAAATGGGCGCGCTCAACTAA
CTGTTACGAGTGTGAGGAACCGTTTAACTTTTTTGTGCGACGTCACCATTGCCGCATGTGCGGCAACTCGTTCTGCCACGAACACTCCAGCCGACGCGTG
TCCGTCTTTGGGATTGGCTTCGACGACGAGCCTGTGCGTGTGTGTGACAACTGCTTCGCCGAGTACTACGCTGTATCGCAAGAATCG