Description :
From Genome Similarity Track
Location :
Scaffold_20:254314- 256223
Sequence
1909 bases(100 bases per row)
CCAGGCAACATTCAAGCAACGTACCCTTTCCAGTGCATCGCGATGGACCACATCCCGTCTCTACCAAGGTCGTATAAAGGGAACACCGAGCTTCTCATCT
GGGTCGATCTATTCACAGGTTACGTGATAGCTAAAGCTAGTGCGTCACGGACCGCGCAGACGATCGCAGAGAACTACGAGGAGGGCGTCTTTCGCAGATT
CGGAGCAAGCGAAGCCATTCGGCACGATCGGGAGCCAGGATTCATACTGCATGAATCTCTAAAACGCTGCTTTTATGGAAGAGACAGCACGGAAATAAAT
TGAGGTTTTCTTGATGAAATTCGCATTCACTCAGAGATTTATCCAATAGCAGGCAAGTAACGATTATTTGAAAAGTTATGGTCACTTTTGCATATGATTT
AAGCGACACTTTAGGTAAGACCGTACTTTTATTTGGCTTCCAGTAGGCGGAAGCCTTTGATGACAATCTCCTTCGGTGTCTGATTTTTTTCGCGCCTTCA
ACCGCACAATGGGACAGAGACAGCGTGCCACTATGGCGTACCGCCCACAAGCCAACGGTACGGCAGAAGGGATGGTGCAGACTCTAACCAGAGCCTCGAA
GATGTGTGTCGCAGACATAAATCAGAAGGACTGGGACGAGTACGCGGAACGTCTGACGTTTGCCCTTAACACGGCGTACGGCCGTATCCGGGGCGAAACG
CCTTTCTATTTGATCCATGGGTGGGACGCTCGATCTACGTTAGAAGTGACACTGCCGCTCGGAAGCCCTCGACGCCGGCACGTGGAGCCACGCCGGTGGA
GATTTAACGTCCAGCGACAGTACCAGCAGGCACGCGGGCTAGTCAACGAGGCGCTGCGCGACGCGATCGAACGGAGAGCAGATCAACACAACGAAGATGT
GAGCTTGCACGACATAAAGGCAGGAGATCAAGTATGGCTATACCTAGATCGGGTCAAGGAAGGCTACGCTCGCAAGCTCGCGCGTATGTGGCATGGGCCA
TTCAGAGTTGCGGAGACCGTCGACCGACACGCAGTACGTTTGGAGACCGCCGGCACAGAATACTGACTATTCCCGATTGTCCACGTGTCAAAGCTGAAGC
TGGTGAAGAGCTACCCAGAGCGCCCAACATCCACGCTGACGAACCGCGAAGCAGATCACGTGGACGTCGACGAAAGCCTGCTGCCCGAAGACAGCTGGGA
ACGCAAGCTCGAAGAGGACGAGTACGAGGTGGAACGGATTGAAGATGTTCACTCGAGCAAGAAGACTCGATACGGCCGTACACGACGCGAATACCTGGTC
TTCAGGAAGGTGTACGCTGAGCCGTCGTGGGTCGATGAGACTGATCTCAACTGCGGAGCGTTGCTAAGAGACTTCGACCGGGGACGGACAGATCGCAACC
GGTTTGAGGCGATGCAGTCGCATGAGGAGTAAACGGTGGAACATCTACGGTGGGTTGGTCACCGTGGAGAAGTAAGAGGAAGAAGGATCTGCAAGAAGGC
TGCAGATTTTAATGAGGAAGCGGTGCATATGGAGTGCCGTGGGCCTGAATAGACCTGAAAACCTAGGCAATACACCCTTAAAAACAATCTGGAAGAACGG
AAGATGATACGCATGGATCAATTCGAATTATATCGAACCAATTCTTCTTAACGACCTAAAAGTTGCTACCCAATACATAATGGCAGGATACGATCAGGAA
GAATGGGCATGCACTTGCCACGCAAGCGAGCGATCCCAAGCGCCGGACAATCCCCTGCCACGTCACGAAAGTGATTACGCCATCGATCGGCCGCGTCCAT
AATAGTCGACGCCTCCAGTAGATCTGCAGGATCGGATCCGTCCTCGATACCAGGATACCAGGCACCTGCCTCGCCAGGTCGAGGGAAGTGCAGGGAGAAT
GGATCACGA