Description :
From Genome Similarity Track
Location :
Scaffold_916:2543- 3959
Transcript NameFunction/comments
Phyta_totarag11337hypothetical protein PHYSODRAFT_323353

Sequence
1416 bases(100 bases per row)
ATCGTACAGATTACCGACGAGTCCACTCTTCACTCTTGCCTCAAAGTCCGATGCTTCAGCCTGTGCACGCGCTAGATCGTCCGCACGCTCGGagacgagc
agctccaggtaTTGTCGTGGCAGTTCGTTCGTGAGTGGACTCTCGACCATGTCTTCAATCACCATTTCATTCCCTTCAGCAAACTGGAAACTCTTGGTGA
TGTAGAACCCGGAATTCTCCTTCAGTTGTCGTGGCGAGACAGTCATAGACTTGACTCGCAAGCGAGGTACCGAGGGGTCCAGCTCAAGGGTTGCAGCTGC
GATATTTGGAGACTCTGTACCAGTTCCGTCACTAAGAACTGTCGGAATAGGCGACCGAGAGCGGTTTGAAACCTGTCGCGCCACCAAGTTCACCTCGTCT
GCCGCTAGCATGTCATCGCACGCGCATGAGAATTCACAGAAAACCTTGGGGCGCGAGGGTGGCGCCATACCCATTCCGGATACACGGGCGATTTTAGCAC
GCTCATCAAGCTGTCGTGAGGATGCACGCATCAGCTGACGCGACTCGCGCATGTCACCATcagaagacggtgaagaAGCCTTCTCTGGGATCTCGTACAC
TACGAAACGAAGAAGCGGGTTGGCCGGCATTACAGGTATCTGAAGTACCGACAAGAACGTAGCGATTTGCGTCACAGTGCCGCCACCATTTTCAGAGTTA
CCAGTCACCAGCGTTGGTAAAACGGTCTCTGTGAAGCCCACACGAGACCACTTCGCTGCCAGATTAGAAACGGGCAGAGGCGTGGGTAAGGCCCCAGGGc
caagcagcgacagcgaaTGGCTGCGACGACTAAGGATTCCTTCTTGGTGTAGCCCACTCTCGATAAACGTGCTGATTGAAGAACGGCGGTAGCTCAGCAC
GGGAAGATCTTCGTAGTAATCGTCCCCGGTAACATCGTTTTCACCAGTATCAGGAGCCGTGTTCTCCGCGACGTACAGCTCAACGAAGCATGCATGCGTT
AGAGGAATGGGTGATACAAGCTGGACTGCAAGTGCAAGTACGTTCTGCGTACCATCCACACTCTCCTGGCCAATTGGGTTGTACTCCGTGTCAGGAAAGT
GCAAGATACCTGCCCAACCATCGCTTAGCCCTGTGCCATTTCCTGACATGGCCAACTTTCCACTTTCCACTTTCTCGGAGATGCTTGACATCGtacggtg
cagcagctgtgggTCTTTAACGTGCAACGACGGGTTCCAGTTCATCCCGTGTAGCCGCGGGTTCcactgcagaagcagaaagcCAATCGGGGGCACCAGG
GTCGGAAGCCAAATGGAGAAAACATACCAAATGACAGAGTTGATACTCCAACTCTTCCAGTGGAGAATAGAGTTCATGATGCAGGATGTTCCGAGCACAA
GCGCAATCGATAGGAT