Description :
From Genome Similarity Track
Location :
contig_40:254278- 257346
Transcript NameFunction/comments
g9060.t1hypothetical protein

Sequence
3068 bases(100 bases per row)
AAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGCTGGAATGGGCTTGCGTGTGGGCTTGACGTGTTAGGCAACACGTTCCGAATGTCTG
CAGCTGTCATGATGGCTCGCACCAGTACGACTTGTCCATCCCGCTCTCCTCCAGCATGCAGCGTGTCATTTCGACCAGCGTACGGTTCATCCGCTCTGCC
ATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCACCATCCCCGCGTTGCAGTATTCACCGCCGT
TGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAACGCCTCACACACTTCGCTCTTCTTGCGCAGTGG
GTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGCCCGACTTGGATGCAGGAGTGACGGGCCCCAACACATCAGAGCAC
ACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTTGAAAGGCTTGCGTGCCTGCTTCGCAGTCGCACACACGCCACACA
CGGTTCCAGGCTCTGCCAGCGCACCCTTGAGTTTCCCGTCCTTGATCATGGAGTTCAGCGTGCCGAAAGACGCGTGGCCGAGTCGCCGGTGCCACAAATC
CATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCAGCTTGCCTTGCTTCCTGCCCGTCGCCACCACTTGGCCGCCGCGT
TTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCGTTGCAGCCGTGAGAGAGAACAGGTTCTTGTTCAAATCTTGAACGTGCAGTG
TGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACTGTTCCAACCCCGAGAATCTTCAAGCTCGCGCTGCTCTTTGCGCT
CGATATGGTGCGCGCAGTCTTTACACCCGAGTACTCTTGAAACGCGTCGCGTGTCTTGCACATGTGTGCCGAAGCACCGCTGTCCATCACCCAGCACTCG
CTAGCAAAAGCTTCCGTCGCATGGAACGCAACGTTCGACTGGTCTTGGACATCTTCATCGGGACTTGCCTCGGAACGGCAATCCCTCGCATAGTGGCCAG
GCTTGCCACAGTTGAAACACTTCCCGAAGGGCCCCTTCTTGCGCATCCCGCGTGCGTTCTTCTTCTTCTGCTGCTGCTTCCCATTGCCCTTGCCGGCAAG
AAGCGCAGTCGCCTCTTCGATGCGGTTCGAGTCCTTCTGACGCACTTCTTCCGCAATCAGCTTGCTCACCAGGTCTGCAAGCTTGAACTCACTCACTGAC
ATGCGAAACGCTTGAACCAGAGCCTCGTAGCTCGATGGCAGACTCCGCAGCATCGTCGCGCAGACGTCTTCCTCAGTTGGCTCACACCCCGCGTTCTTCA
TCTCCATCACGAGCTTCTCCAACTCCGTCACGTGCTTGCCGACGGAGGACGCCGTGAACTTGAACGCCGAGAACTTTTCCTTGAGCCACAGCCGGTTCGC
CATGTCTTGAGTCTTGTGGAACTTCTTCAACGTGTCCCACGCCTCCTTCGCAGTCGTGGACGTCACCACGTGCATCAACTGCGAGTCATTCAGGTTGAGC
ACAATCGCCGCGTGCGCTTGTTGCTCCTTCGCCGTCGATCCGGCTTCCCCGGAGACAGCTTCCCACAATCCCTTGGACATCAGGTACATCTTCATCTTGT
AGCTCCACAGCGAGTAGTTCGAGCCGTCGAAAGGCTCGACCTTGAACTTGGTGTCGGTACTTGGGCTCATAACCAAAAGGAAGTTGGGCTACGAGCTGCG
GAGAGTTGAAAGCTTAGAAGACGGCTTCGGGCCGAGATTGCAAAACCAAAAGTGAGATTGATTGAGTGAGTTTTAGCTGCTAGCCTGCCTCCTACGCTCT
CTTGTCGGCAAAAAGAAAAACGTCCATGTGGGGACTCGAACCCACACCCTACGGATCAAAGACCCGGCACTTAACCCACTACACCATACTGCATGACCAA
AGTCACGCACACCCTACTCCTACATATGTAACTCTTACTATGCACCCACACGCATGTCCACGCCGCTTCAGCACTTGGACACGCTCCCACACGCTTGTTC
TCACGCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCTACAAATCCCCCCGCACACGCGTAGAGGCACGCGCACGCACACATGCCTTGCA
CCCACACCTGGTGCACACACGCACATGCACACGCAGCACCCTCTAACAGAAGAAGGGGCCACGTCTAGGGAGATGGGTATGCATTTTGTATGGTCCCAGC
GGCGGGTGTGTAAGCTGCTTGACTGTGCGCTCCAAGGTGGTGGTGTCAAAGGGAATTGCAGTCGGGCCATTGTGCGCGCCTGGTCTGCGTAGTACAGTTA
TACAGTGTGTGTGTGTGGTGGTGGTGGTGGGGGGGGGGTTTCGACGGGCAAAGTGGTGTCGGTGCTGTCATGTTTTTTGGCGGGTTGTGTCGGCAGGCAC
AGCGATGCGGATGCATGTGTGTAGTAACGTTCTTCTCTTTTGGAATGCGTCTAGTTGTTTGTTTGTTTTGTTTGTTTGTGGTTGGATGTTGTTTGGATGT
TGGTTGAATGTTGGTGTTTGTTTGTGGCGTTTTGGTTGGTGTTTGTTTGTGGCATTTTGAGGGGGTGAAAATTGTGTGTCGAGAAGTGAAAAGTTACGCC
TGTGTGGCTCAGTGGTAGAGCATCTGTCTTGTAAACAGAAGGTCCCGGTTCAATCCCGGGCGGAGGCATGCCTTTTCCACGCTTCTGTATTCCATCTGTG
TCTCAAGACCGACACGCGCGCACGCATAGCCTTGTTGCTACGGTTTCGCGTGTGAGCACACCAGCGCACGACGGTTTCTTGTTGCTCCGCTCCATCCGTT
TTCCTCCACCTTGTGTGCTGGGCCAGGTAGCCTGGCTCTACTGCGACATGTGGAGGGCCGTGGTGATT