Description :
From Genome Similarity Track
Location :
contig_40:254265- 257333
Transcript NameFunction/comments
g8662.t1hypothetical protein

Sequence
3068 bases(100 bases per row)
TTTTGCGTTTCTGCTTGGTCACATGGGCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGCTGGAATGGGCT
TGCGTGTGGGCTTGACGTGTTAGGCAACACGTTCCGAATGTCTGCAGCTGTCATGATGGCTCGCACCAGTACGACTTGTCCATCCCGCTCTCCTCCAGCA
TGCAGCGTGTCATTTCGACCAGCGTACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTC
GTCGCACAGAGCCACCATCCCCGCGTTGCAGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGA
AACTTCTTGAACGCCTCACACACTTCGCTCTTCTTGCGCAGTGGGTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGC
CCGACTTGGATGCAGGAGTGACGGGCCCCAACACATCAGAGCACACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTT
GAAAGGCTTGCGTGCCTGCTTCGCAGTCGCACACACGCCACACACGGTTCCAGGCTCTGCCAGCGCACCCTTGAGTTTCCCGTCCTTGATCATGGAGTTC
AGCGTGCCGAAAGACGCGTGGCCGAGTCGCCGGTGCCACAAATCCATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCA
GCTTGCCTTGCTTCCTGCCCGTCGCCACCACTTGGCCGCCGCGTTTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCGTTGCAGC
CGTGAGAGAGAACAGGTTCTTGTTCAAATCTTGAACGTGCAGTGTGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACT
GTTCCAACCCCGAGAATCTTCAAGCTCGCGCTGCTCTTTGCGCTCGATATGGTGCGCGCAGTCTTTACACCCGAGTACTCTTGAAACGCGTCGCGTGTCT
TGCACATGTGTGCCGAAGCACCGCTGTCCATCACCCAGCACTCGCTAGCAAAAGCTTCCGTCGCATGGAACGCAACGTTCGACTGGTCTTGGACATCTTC
ATCGGGACTTGCCTCGGAACGGCAATCCCTCGCATAGTGGCCAGGCTTGCCACAGTTGAAACACTTCCCGAAGGGCCCCTTCTTGCGCATCCCGCGTGCG
TTCTTCTTCTTCTGCTGCTGCTTCCCATTGCCCTTGCCGGCAAGAAGCGCAGTCGCCTCTTCGATGCGGTTCGAGTCCTTCTGACGCACTTCTTCCGCAA
TCAGCTTGCTCACCAGGTCTGCAAGCTTGAACTCACTCACTGACATGCGAAACGCTTGAACCAGAGCCTCGTAGCTCGATGGCAGACTCCGCAGCATCGT
CGCGCAGACGTCTTCCTCAGTTGGCTCACACCCCGCGTTCTTCATCTCCATCACGAGCTTCTCCAACTCCGTCACGTGCTTGCCGACGGAGGACGCCGTG
AACTTGAACGCCGAGAACTTTTCCTTGAGCCACAGCCGGTTCGCCATGTCTTGAGTCTTGTGGAACTTCTTCAACGTGTCCCACGCCTCCTTCGCAGTCG
TGGACGTCACCACGTGCATCAACTGCGAGTCATTCAGGTTGAGCACAATCGCCGCGTGCGCTTGTTGCTCCTTCGCCGTCGATCCGGCTTCCCCGGAGAC
AGCTTCCCACAATCCCTTGGACATCAGGTACATCTTCATCTTGTAGCTCCACAGCGAGTAGTTCGAGCCGTCGAAAGGCTCGACCTTGAACTTGGTGTCG
GTACTTGGGCTCATAACCAAAAGGAAGTTGGGCTACGAGCTGCGGAGAGTTGAAAGCTTAGAAGACGGCTTCGGGCCGAGATTGCAAAACCAAAAGTGAG
ATTGATTGAGTGAGTTTTAGCTGCTAGCCTGCCTCCTACGCTCTCTTGTCGGCAAAAAGAAAAACGTCCATGTGGGGACTCGAACCCACACCCTACGGAT
CAAAGACCCGGCACTTAACCCACTACACCATACTGCATGACCAAAGTCACGCACACCCTACTCCTACATATGTAACTCTTACTATGCACCCACACGCATG
TCCACGCCGCTTCAGCACTTGGACACGCTCCCACACGCTTGTTCTCACGCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCTACAAATCC
CCCCGCACACGCGTAGAGGCACGCGCACGCACACATGCCTTGCACCCACACCTGGTGCACACACGCACATGCACACGCAGCACCCTCTAACAGAAGAAGG
GGCCACGTCTAGGGAGATGGGTATGCATTTTGTATGGTCCCAGCGGCGGGTGTGTAAGCTGCTTGACTGTGCGCTCCAAGGTGGTGGTGTCAAAGGGAAT
TGCAGTCGGGCCATTGTGCGCGCCTGGTCTGCGTAGTACAGTTATACAGTGTGTGTGTGTGGTGGTGGTGGTGGGGGGGGGGTTTCGACGGGCAAAGTGG
TGTCGGTGCTGTCATGTTTTTTGGCGGGTTGTGTCGGCAGGCACAGCGATGCGGATGCATGTGTGTAGTAACGTTCTTCTCTTTTGGAATGCGTCTAGTT
GTTTGTTTGTTTGTTTGTTTGTGGTTGGATGTTGGTTGGATGTTGGTTGAATGTTGGTGTTTGTTTGTGGCGTTTTGGTTGGTGTTTGTTTGTGGCATTT
TGAGGGGGTGAAAATTGTGTGTCGAGAAGTGAAAAGTTACGCCTGTGTGGCTCAGTGGTAGAGCATCTGTCTTGTAAACAGAAGGTCCCGGTTCAATCCC
GGGCGGAGGCATGCCTTTTCCACGCTTCTGTATTCCATCTGTGTCTCAAGACCGACACGCGCGCACGCATAGCATTGTTGCTACGGTTTCGCGTGTGAGC
ACACCAGCGCACGACGGTTTCTTGTTGCTCCGCTCCATCCGTTTTCCTCCACCTTGTGTGCTGGGCCA