Description :
From Genome Similarity Track
Location :
Scaffold_264:25417- 38896
Transcript NameFunction/comments
Phyke_g7488hypothetical protein PHYSODRAFT_469320
Phyke_g7489hypothetical protein PHYSODRAFT_466632
Phyke_g7490hypothetical protein PHYSODRAFT_309129
Phyke_g7491hypothetical protein PHYSODRAFT_248463
Phyke_g7492hypothetical protein PHYSODRAFT_470700
Phyke_g7493hypothetical protein PHYSODRAFT_477864

Sequence
13479 bases(100 bases per row)
TCGACCCCCATCGCTTTTAATGTTGGCACCCTCGTTATGCCCCTCGTGGCCAGCcgcttgctgctcctgcttcttgtaACGCTCTCTCTTGTCGCGACTG
GCGCGGGATCCTCCACAGTCGTGCGACTCGTGAATGTCCACCCGCACAACGTCAGCGCCTTCACAGAGGGACTCGTTTTCGATGACGGGGCACTCATCGA
GTCCACGGGTCTCAACGGAGAGTCTTTCATCCGCAAGTACCAGCTGTCGGAACTTAATCCAACGTACTTCCAGACAGGGGCGACGGAATCCGTGCCGTAC
CTAAAAGAATTTCGATTCGACTCGACCGTTTTTGGTGAAGGCGTGACTGTTTTGGGTGACAAGCTGTTCGCGCTGACgtacaagaagcagcaggtgctgg
tgctgtcaCGACATGATTTCCAATTGCTTGATCAGTTTCCACTTGTGACCTCCACGGGAGAGGGTTGGGGACTTACGACCGACGGAGAGTTCCTCATTGC
CAGTGATGGTTCAGCCACAGTGCAGTTCTTCGACCCTCGCGACGAATTCTCGCTGCATCATAACATCACTGTCCGCAAAGATGGTGTGCCTGTGACCAAA
GTGAATGAACTGGAGTACGTGGAAGGTGAACTGCTGGCGAATGTCTGGTTTGAGCACCACATTTTGCGCATCGACATCACGAGCGGAGAGGTTCTGGAGC
AGATCGACTTGGATTGGATGCCCAACATGGTGGCTAATATCCACTCGAAGTCCATGCAAATTTCACCTTTGAAGGTCGAGGCTGTGATGAATGGAATTGC
CTATGACCCGGTGAGTCACCACTTGTTTTTGACCGGCAAACTTTGGGATTCCAtgtttgagcttgagctctcataTCTCAACTCGCACCAACAAGCAATC
GTGCCTTAGATCATTTGGGCTTGGGCTTCGCAAATTGAAGTGCTAAGGACAATGGAGATGGTGACCCCTTGCCAAATTGTGGTTGAACGGTCCAACCACA
ATTTGAAAGGATGAGAACACTATGGACAAAGTACGTGTATGTAGGCAAACAGCACTAATGTAAAAGATAATTAACCACATTACGACTCACTGCCTTCGTT
CAGCAGACTACACCGATCTACGCAAACTTCTCCGAGTGGAAATCAAAATTCGTGCCGTTTGCGCCCGACGACGAGTATTTCTTGCACATACTGCCCAGCA
CTTCCTCCAGTTCGTGAGGTCCACAACAAAAAACGCCAACCTCCTCCCCAGGGTGATTGGACTTGGCCTCTGAAAAAATCCTGTCCCAGTCCGGTCGACC
AAAGTGAGTGAGCTGTTTTGTATCCATTCCGGATACGAAATCCTTGCCGGTTTGTTCATGCACGAACTCCTGGAACATCTTCAGTTGCGACGTATTCTCC
TCGCCACCCAACACAACTGTGCTCAAATACTGATGCGTCTCAATCACATTGTCGCGGTCCATCTGAGAGATTTGGTTCATGGTACTCTCAAACCAACTTA
GCGACTCCTGTGCTCGGGTCACCCAGTGGAAGTAcagcttctggatcttgAACGAACTCGGGTGACGGACGTGGTTGCAGTTGAGGCAGCGGTTGTCCTC
CCACAGATGGACGACATCCTTTAGAATGGAGGCAAATGGAGTGACGCCAATACCACCGCCAATGCAGATGACAGTCTTGTAGCGGTGGTAATCTTGTGTC
GGCGCTCCAACCGGGCCGTCGAGGTATACATCTGGGTACTGCAGATTGCTCGCATGACAATCAGAAATCACTCGAGCTATGGCATCCGTCCAGTCACCGC
AAACACGGATGTGAATGCTGATATAGTTGTCTCCAGGAGCGGACGAGATCGTAAACGGGTGCCACTCGTGAGAAGAGATCTGTGGGCAGTTGAGATACAG
GTACATGCCCGGGCGATACACAAAACGGCGAGGCTTTTCGAGGAACAATGCGACAGTACCATCCAACTCCATTGCCTCCATGATGCGGACCGGTGCAGCA
AACATCTTAGCGTATCGGAAACGACGTTCAATGAGGTAAATGAGGAATGGAGGTGTGATCCAGATGTAGGACGAGCAGCGAGCAAGCCACGACGTCGCAC
CATGGAACGACAGCACGATGAGGAACGGGCCGAATAGCATATGCGAGTACCAGAAGAGGTTGAACTTGCCCTGACGGAACTTGGGAATCGCAGCTAACGG
GAACGAGATGCAGGTGATCACCAAAAGAATGACACCGGTCCAAACTGGTAGGGCCTGCAGCATCGTAGTGAAAGGAGGTCGTTCACCGTTAACGAAGGTC
GATACGTGACGAGTCACGAAAATGGAGCGCTTGACCTCTTCTGGAGTAGCAACCAGGTACAAGTAGATTTCGTTGGAAACGTGAGCAAGTGTGTGGATGA
TACCAGCGATGAGTAGCACACTGCCCGAAATCTTGTGGAACGCGATGTGATCGTCGAATGGAATGTAGCGCCACAAGAACCGActgcgcttcatcacctG
GGTGATAGAGCGGCACattggcaacagcacaaagACACAGTTGAGCATGGCGACCTGAGCGTTGGCACGGGCGATTCGCAGACCCCAACCGATCGCGGGG
TCGACCTCGTACATGAACCATTTGACCCAGAAGGCAATATTGTTCAAGATGAAATAGACCACAAGCCACCAGATACGCAGTTTGTTGTCACCGTACCAGC
GACCGAATTTGCTCTTGGGGCGGTTCGGTGCTGCATACACAGGTTTCTCGACGTCGAGATGGTAGGAATCGGTCACGTACGGCTCGAATACTGCCTTAAA
CTGGCCAAACGTCATCGCGTCGTTCTGCACTCGACCCTTGCGGAACATCAGCTTCGCTACTGTTTTGAAGTCCACACCCACCACATCGATTTTGGCATTG
GAAAAGTTCGACTCCAATAGCTGAACGATCTGGTCCTCAACCACATAGCCGGAGTTATCGGGATCGAGGGTGTCGAAGATAAAgcgcagcttctgctcgg
cACCAACACTGAGCTTCATGACAGCGTCAATCAAGATAGCATTGCCGTCGATCGCACCGTTACCGGTGGCGTATCCGTCGAATTCATTGCCATCGACTTC
GAATGCTTGCGAAAAAGTTTCGCGCtcgatgtagccatctttgTCGGTCAAGTTGCCCATTGCGTCACGTAGTGCCTCCAGCTTTTCCATAGGCGTGAAT
GCCTTCTCATCCATGCTCATTGCAACATTGTACTTCTGTTCAAAGTTGCAGTCGCCAGGAATTGGCACGGTCACCACATCGCTTCCGGGAGGCGGGCCGT
AGGTAAAATCCCCCTCATTGGGTGCAGGTGCAGCGTATCGGGATTTTTTGTGGACCCCACTGGAAGACGCACTTGCCGACGACAAACTCATACTTTGGCG
CACCATGTTCGAACGCATCATGGCGTCCACATTGGCACGACGGCGACGTGAGCGACGGTTAGTGTTCCTGCAATTGCTTTTACCGCCAACGGCATGAGTC
GTCGTGGAGTTCATCGTCacgaacttgttgctgtccaTGAAGTTGGTGGCGGCAGGTTTTCGGAGCGGCGGGTTTTGGTTCACGTTGACCATCGTAGTCA
TCGTAGGTAGGGCCTTGCCACCGAAACGAGGTGCATTGGGCGACGGCGTCGACACGTCAATGAGTGCCTGTGTTTTCGCTGGAGTGATCTTCAGGTCGTT
TTTAGGCTTGCCACGACCGGCGGCCTCTCTTCTTTGGCGATCCATAATCGATGGTGCTTTCAGCAGTCAGGGCTTAATCGTTCAGGTTTGAAGCACCTTT
GGAGACGTCCTGCAAAATGAAAAATGGGGGAACTGAGAGCTCTGTGCTTCCTACTGCACGACAGTACCGCCATCCCCGTGGTTCTTGAACGGGGTTTGAT
GGTGAAAGAGGGAAGCTTACTTGTACTTGTATGTAATTTGGACGCTAGAAACACGCGCCACTAGGCTATCTTCACGAAAATGCGCTGGCTCCAGGTCCTA
TACTTTTGCAAGGATACGCTCACTATGCTCGCCGTCGAAGTAACAAGCCTGGGCTCATTTGCCCTAAAGAAGACAGGTCATGGTCCGATGAAAGTATCCC
TGTGTCACATTGCCAACTTTTCCATGGCTACAATGCACCTCCCAATCTAAACGGATGGATGCACCACCAAAAGTTTAGAAAACGGTGGTTTGAATGATGC
GGCATCTGTAATCGCGCACGGCTCGACCTGGACTGCCGGTCTGCAATTTGACTGGGTCGTGTCTCTTAATCATAGCGACACATGATGGAGTCCCTAACGC
CTTTCGGGGTGAACCAGCGACAACGCGTCGATCATGAGATGGTCAGGCGCGCAAACGATTGAAACTTGCCAAACCGTGGTGTTGTTTCGCACCATGTAAA
TCAGTCAGCTCCGGGCCCAACGCAGTCACGATTGTTTGCTCGCATTGACGTTAAAAGACATGGAAACGCAGAACCTCCTCCCCTTTTACGATTCCAGGCG
GCACAGCCGAAGATGCTCATGTAGAGGACGCCGAAGCGCGTTTCTAGGGGCGCACGATGTTAAATCGTCTTACTCAAAACGAACGACGGACCCTCGGTAA
AGGTGTCTTCGGTCCACCGCAAATTGCAGCCCGCATAGGCAAAAAGACATGGAACGGATTTCGCACATCGACTGACGTCTTCGCCTTCGCAATCTGCATT
GCCAACGCCATTAGTGCTTCGAGCTTCGAAACAAGGCGTGTGATATGCCGTGCATCTGTAGTTTATGCGGACCAGTGGACCCTGTCGCCGAGAGCCCAAG
GCTTGAACCAGATCGCTGCCAACGGATCGTTGGTGATGGATGGATGCCTGGAAAGCACCTTTGACATAAATGCACGATCTGCCGTGGATCAAACGAAAGG
CATGTGGTTTGGAGGAAATCTAAAGTTCACATCTGCTGCGATTCAAAGTGTGCCTTTGGAGTTGATTCATAGACCAGGCATCAAAATGGCAGAAACAATC
GCACATCAAGTTGACGCCACCTTCAACGTCGGGTATATCCATAGAGGGCAAGCCCATACAGcaaggagcagctcaagagcgCTCTTATGCATATGTTGTA
AAAAATGGTGACTGTAGAGTTCGGTTCCTATCTATTACTATTGGTGCTTACAATTCACTAGGACAGGCCCTGCCCGTCAGGGAACAAGGGTTCATGGCTC
TGTACTAGCCtattgcagttgctgaacCAATGCTCATAGCCTCGCTTACATTGCTCTACAAAGTGATCCGTGGCCAATACCATTAAGGTACAATAATGTT
AGGAATGTTGCAGCCGCAAATGTTatgcaagcagctcgttAGAAATTACCTTGAAGGGGCTACGGCGCTTTGGTCGATTTGACAAGCCTCTATCACGACC
CGGAGGAGACTGGGCCTGTGGTGGAAACCAGAGGCCAGCACCCGATTCACGGGTTGGATATGTAGACTTCCATCGAGCGTTGATGTCTGGCCGACTTTCA
AGCGATGGACAACTTTCCACACATGAGGAGGAAGCACCCAAGTCAAAATCGCTAGCTACTTGTCCGTTGCTGTATGCGTAACCTTcgttgtcatcttcgt
catcctcttcttcttcttcttcttcttgaagtGTCAACTCATGGATTGTGAGTGCCTGTTCCTCTagacgcttcttcagcttttgtCGCTCCAGTTGCAG
CGTTTTGATTTCTCGCAGATACTCGCCCTCTTTCTGCTCATTGTCGCTCTGCCAAACGATCTTCTCGTCCCGGAAACTGACCTTAAGTCGGGCTACTTCT
TCACGTAAGACCTCGCACTCGTCATGAAAAGCAGGCACCGCAACAACTAATGGTTTCGGGCTCCCTGCTGCATGGTCTGGAGTATCTGTCGACAACCTAG
ATACAGCGGACGAGTCCAATTGACCAGAGTTTGATACTAGCTTCACTTTTGATGGAGACACGTAGATACCGGCGGCTTTGGATTGCAGCAAGTCATCTAT
CGTGTGAGCTTGTTCCTGCATGAATAAAAGCGAAACAATTACAACGTTTAGATATTCGTCTCTGCATGCGTTCACACTCAGGTGTCATACACTACCTCGA
TAAGTAAGTTAGCACTCAATTGTGCTTGAACAATCTCGTTCCAGTGTTTTGATTTTTCCTGTTTGAGCAGCTCATACTGCGCGACAAACTCCTCATATCG
CTTTGTTAGCTGCTCGTGGTCTTGTATAAGTGATTGTTTCTCTGCTTCGAGATTGAAAATCTGTTCTGCAAAGCGCTCGTGCTGTGAACAAAGCAGCAAA
AGTTGGGAATCGAAACCTTCAATTAAATGAGGAGACTACGTACTTCTTCAAGGCGGGCCTTTTCGAATTCCTGGAGTTTGTTACTCTGGTCTGCAGTCTA
ATTGACAACAGGCAATTAGTTTTGTAAGGAAGACGAGTTCCAAAAATGTATAGAGCTCTCTTACCACTGCAGTGAGACTCGTCAGATTTTCTACGAGGTC
TTGCATCGTTTTCTTCGTTCCTTCCATTTGCtgtgcttcttgatctcGCTTTATATTCATCTCACGCGCTTTGGATTGGGCTTCCTCCAGCATACCCGAC
AACCTTTgctctgtttcttgcagATCCTGTTGCTGATTCGTTACGGTCTTACATTTGGTTTTCAACTGATCGCATTCTTGGGCGGCAGTCTGCAACTGTC
GACAGACATCCATGTACTTGGAGTTCACTTCCTGAAAGCGGTCCCAACGCTCAAGCTCCAAGTTCTTCGTAACTTCCAACCGCGTTTGCTCACGCGCTGC
ATCCAACTGGCACATGAtttcctgttgcttctgctcggGAGTTTTTAAGCATTGCGGACAAGTGGCGTTGAtttttttgtgctttttttCGATTTCCCAG
CACTCTACCTCTTTCGCCTTCATTGTCTGTTCATGCCTCACCTTCAGTTCCTGCATAGCCTGATACAGGTGCTCGTTGTCCTCCTCGATGCATCTTCGAG
AGCGAAACAAACCATTGTAGTCTTCCTGTAGCATCATGAGCTGCTCCTTTGAATGTTGGTAGTTGCGAAGTACTTCTCTCCATTTATCTTTCATGTGCTT
CACCAGCATGGTGTGTTCTGTCTTGAGCTCGCTCTTACCATGCAGGGCCTCCTGCAGTGCTGTTGACAAGTCCGCCACTTTCCGTTTGTACATAATCACT
TCACCTGCCATTTTCTCCTTTAGTTGGAAACTGGAGCGCTCGCGGTAGCGCGCTTCCTGTAACTCCTTGTCGACAAGTTGCAACCGCGTCTTGCACTTCT
GTAGTTCGTCTTCCATAGGGCGATGTGTATTTTGCCACTCCTTTCGTTCGCTTTCCAACTTTCCGCGTAATTGTTCCACCCTAGCGCGAAGTGCCTGCCG
TTCCTCTTGTGTGGCGCGTACATTTGCTGCCGCCTCGTTTTTCACCAGCGATATTTTTTCGTCGTGCTTCTTTTCAAGTgtgcgcagcttctcgttAAGC
TGAGTGGCCTTAGCTTGGTCCTCCTGCCTTTGGTCTAGTGCAGTCTCCAACAGTGAACTAGAGTGCGTAAACTGACCCTGGAATTTGGCGCGCTCGGCCT
CCACAGCTGCCATGGTCGTCTGGAGTGCCACAATCTCGCGCTTGAGCTGGATTGCATGTGCGCTCGCCGCAGCCGTTGCACGGGCAGCACCCTGAtcctt
cttcaccaattGCTGTCGTAGAGTCTCAAGGTCACGCAGAAACGAGCGGCGCTCCTACAGAGATGTAAGGTAAGTAATTATcaatcaagttgaagtgtcc
ttcgtctacagcttcaacatgtcaacttcagcagctggGACGAATCCATACCTTGTCGAAGCACCGCTGTGCATCTTTAAGAGAGAGCGTGGAGGCAGGT
AccttcgccatcttcttccgGACGAGGTGCCACTTAGCGCGTAACACTCATGAATGGGACGCGGTTTACTCACGTACATGCTAATCTTGGGCATTCTAGC
ATCGGTTTTGAAACCGCGGCACGTTAACAACGCTCAAGGAGTGTACCAAGCTCAAAGCACAGGGCTCTCCCTTTGTCGGCATGGTCTACTTCAACGAGGG
AGCTAATCACATGATGAAGCACGCACTCCGGTAGTATCAAAAATGAGGGGTCAAAACCATATCCGCACTTGACATACGTACAATATAGTGCTCCCCCTGC
CATGGTTCTGCGTCTGCGTCAACTGCAGGTGGTTCACCGCCATGGCGATCGTACGCCGTTGCTCAACATCTTCCGTGGGAGTGTAAATGCTCGggcagag
aaggaggaagcGTTGATGTGGGGTCGTCAACTGCCGGAGGCTGAGGAGCTCGCGCAACTCCGTGACAAGTTCAGCATTCAATTTGGCGGCGAGGCACAGA
GCTCGTTCCAACAGCGGCCGTTCGGATATCTCACTAGTAGAGGCTTCCAGCAGATGAAGTTGCGTGGGGATCGACTGGTGAGAAGTTTGTTTTGCGGAGA
GGTCTGGAGCCTATGACTCACGGGTGTGTATGGTGGTTGTGCACTGTCATAGCGAGGGTTCTGCAAGAAAGAGGTTTTTAACCTCGCTGAGCTGACGTCC
AATGAAGTGCAGATCTTCAGCAATGCGTACACGCGCACGCAGCTCAGTGTACAGTCACTACTGAGTGGTCTTTTGGAAGACCAGCCACAGATGCGCCCCC
ACGTCAGTGTGCTCCCCCCGGAGACCGACATCATAAACAGTAAGTGTTTGAGGGAGGtatttgttttgtgtgttgATGATCTTACAGAGAGTTTGTCTGT
GGAGATTAGCGTATGCGGCATTCCCAGAGAtcatggagatgaagaaggatCTGGAGAGGGATAACGCTGAATTTGCAGCTCGTGAGCACGAAATGGCACC
TTGCAAGCAGGAGTTAATGCGGCTGCTACCGGCTATTAATTCGGGCCAGGTCCCGTTTACATGGATGACCGCAGCTGATTACTTTGTCTGTCGCCGTTCA
CACAACGTCCCATTCATCCCTGGCACCAAGGTTCATGGAGAGGCCACTGAAAGACACTTAGGCTTCCGCTTCCACCAAGTGAGCAATACGACTTACCAAT
AACTACTACTAGTATTAACATATGACAGGAGCTTACTGACGGTGTTATGATGTCTGCAGTTCTACTCGCATCGGACAATCCTGAAGCTTGTGGCAGGGCG
GCTGATGCACAACGTGCTTTGCGAGGTACATCGTATGTAGAGCTTACGGCGATGTAGAGCAGTATTCAACTCACTTGATGTTGTTCTTGTGGAGTTCAGA
TGCAAAAGGCGTTGTGGGATCACAGTGAAAGCAAAAAGCTTGTGATCTACAGCGGACACGACGTATCACTTCTGTCGGTCCTTCGCACGATGGATGCAGA
GATCGCGAATGACATCGGCTGGTGGCCTGAGTACTCCTCGGCTCTTGCGTTGGAATTGCTGGAAGATGAGAACGGGAAGTTCTTCGTTCGTACTCGACTG
AACGGCGAAATCCTTGCGATcggtgaagctgcagaggGACAGTGCTCTCCAGACCGTTTCCGCGATATGGTTCTGGATCATATCGGAAGTCGCGCAGAAT
AAGTATTTGCAAGCAAAATGCCGGCTCCGAACCAGGACTacaaataaaaaaaactagaccaagaagagcttaTAGAGACGAGTTAAGCTAGCAGCTCTGC
CACTTGCAGCGCACGTTTGTAACGTCGTCGGGCAAGCTTAATACTGAGcattttctccttctcttccgctgcagcttcctcttcctccttcgCTGGGACA
CCAATGTCGATAATATCTTGTGCTGACTCCATCACACGCTGTATACCGTCCAAATACACATGTCAGAAGAGCAGTCCACATAACAACAACACCTCACTGA
AGTCAGCACTAACCTTGCGTGCAACACCCTTGATGCCGTCCAGATACTGTAGCACAACGGCGAACATCCCCTTGGGGACAACATCCGCCTCGAACATCCA
CTGAAGAATCCACAACTGCCTCATTTTCTGCATTGATAAATACAAAAACATATCAGTTAATTGACCTGTTGTCGAACTCCTGGTAGCGTGAGTCAGTTGA
CCAACCTTGAACTTCCAGGGCAGTTCATCGTCCGCTTTGGGCTCGTCACGTTTCTGCCATTGCTCGAGATAGTACTTGGCTTGTTGGATCATCTCTGGAG
ATCGGTCAGACTTGCCACCACCCTCTTTAGGcgtctcgttctcgtccttcttcttgttggcagGTCCACGGTGCTTCTTGGGCACCACCTTATCTCCATT
GTCGTTAAATTTAACGTGGGACTTATTGGGTGCGTCAGCTACTtccttcttggacttgacaGCTTTCTGTTTGCCACGTTGTTTCTTCGACGGCTTCACA
GCGCCCATGATACACTCAACCCAATGCAGTGGATGCCCTTGACGTTCGTCCTATTGCTACAGTTATTGGTCGCGATGCCAGTCAAATCATGCGACGTGTG
AAAATGGTGTGACCCACCTCACAAGCGCTCTCATTGGTGGAATGCTGAATAGAGTCATCTGATTGGTGGATTCGAAAATCCCCGCGGGTACGGAAAGTAG
CGCCAAAATCGACAATCAACGTGAGGTCCGTTATGTGTCACTTGGCTTCTTACACGGGCACAGTCACGGCCGTCCTATCTATCCTGTACCATCCTACGTT
CGTCTCCAATTGGATGTCCAACTCCTGTCAATAGATTGTCCATCTCAGCGTCTCATCTCTCATGTGCATCAACCGCAAACGCCCTCGCACTCCGACGACC
tcccagcagctccaaactgATGACTCCATACAGAAGCGCGTCAAGACTGAGTCCCCCACGTCCATCGACCGCTTAGGTCTTGCAGGGCACGATCAGgatc
aagatgaagagcatgcGACAAGTGCTCATCGAGATGAGATGGTTGCAGCCCTTCTGACCATCACGTCGGCGCTTGGACTCTCCAGGGAGACGCTGCACAT
GTGCGTGGGACTACTGGACCGATACTTGGAGATGCAGACTGTCGAGGTGCATAAACTCGAAGCTCTAAGTATATCGTAAGAATGACATGCAGCTATAGGA
TTTAAAGAGTGGAAGAACTTCGAACTGACGCGGTTGctgtgcttgttgttgtaggTGTTTGTGGATCGCTGTCAAGTTTGTTGAGACTCCGACGACGATT
TATGACAAGAGCATAAAGGAGATTTTACAGCGACGGAGACATTCCAGCAACGTACGTTGGTTGTTTAAGCCAGCTAAGAGGGTTTTAGCAATATGGCTAA
TATGTGagttgtgctgttggtgtcaaTAGTGGACGTGGAATGAAATTCTTGCGTTCGAGCTGAAGATCTTGCAGCTTTTAGACTTCCGGATCATGTCCAG
TACCGTCTTGGGGTTGTTGCAGAAAAAATTTCACACCCTCcaagaggaaggaggagacgacgacgatattCTACAGTCGGAGGAATACCAGCTAGCCCTG
TACTTTGctgacttgctgctgctcaaggcACGAGCCAACGAGTTCTCCAAAGAAGTGCTCGTTGATGCCATCTGGTTCGTGGTATCCGGCAACCTCATTG
CAGACGTCAAGCCGTCGCTGTTACCACCAGTGCTACTGCTCTTCCTCGCGCACCGGGATAACATTAACCCGAGCCACCTGGTTTTCAAGTCATGGTTCGC
GCTACGCTGTCGCTATGGCCCCTTCCTGTCATCACCCTGGACAGTGCCCTACGACCCATCCTGCGTCTGCCGTGTCTGTGAACACGTGCAAGACGAACTC
GCGTCGTCATGAATCTCAGCTGAGCCGGTTATGTCGTGACGCCACCACTACTTCACCCAGTACAAATGTAGACCATAGACTACTTAAAATTTTGAACAAA
ACACAATAGATGTACCATAGCtttccagcaccatcaacaTTCACCCAAAACAAAAGAGTGACGTTAACAACAGAAGAACGATCGATAACGTCGATAAACA
TGAAAGTGAGCTACCATTTGGCCCCCAGAGATCTCATCCCCTAGCTGTGTCTGCACTTGGTCGTCTCTAATGCGACTGCAATTCAACTAGTAGCCGATCT
GGGGGTAAATCATGTGACGGTGGTCGACTACAGGAAGTGAGTCTTGCGTAGGTCTTGGTACTTCTTGTATCCAGCACCTGCCACGCCGGCAATGATcagc
aagatgatgaagaacggAGTCTTCCAGCTGCTAGATTTGGCGGCTGTTTCCTTCACGGTCTCCTCCAACTGCGAGTCCACCTGGTCGCGGATGGCGTTCA
CCGTGCTGTGTACACGCTCGACCACCTTTCCGTTAGCCCAGGCCTCGAGTTCAGCAATACGCTTCTCGTCCTCCGCGctctgctccttcagctttTGGAT
CGTGTTTTCGGTCGACTCCCTCAGAGCCGTAAATTGGTACTCGAAATCCTCGAGCATCTGAGCGTACTTCCGTTTAACTACCTTCatcttgtcgtcgttg
ttgccaTTGGCCAGCGTTTCTTGAAGGCCTTTGTCCTTCACATTGCGTTGattctcgtccttctcaTTTGCAAGCGAATCAATCACATCACTTCatcaac
acagcagcaaattagaaaaaaacaaatatcAGTCTCATCGACAAAAGAATCAGCAGACAAGATTGCCACAAAACTCACTCGTAGATGTTCACTGAAATGA
CATCGTGGTTGTCAGCGAGACCACCAGTAGAAGCCGAGATGCCAATGTACGCGTCGTTCATCCAGGCGTTATCGAACGCGAGTTTTTTGCTGTAGCACTG
GACCCAGTTGCCCGATGCGTCAGCGTCAATCAAGATCGTGAACTGGTTGTCTGCCTTTGTGTACGCGAGTTTAGCACGGGACATGTTAAGTGACGGACTA
AACGCCGCATTCTTCTCGTGGTAGCGGATACCAGGAGCCATGCATCCCACTTTTTCCATGTCATtgagctcgtccagcgtcttgGAGCCGTCGTTCTCGA
AGAACGTCACATCCTTGTGGCCACCGCCATGTTCCTGGTTCACGAACGTATCGAATACGATGCCTAGGCCCTTAAATTCCCCAATGAAGCCGTGGTTGTC
GCCCTGCACGTACTTGCTGGTCGTGAGCCAGAGCGCCAGACCGTCTCCGAACCAAGACTTGGCCTGGCCGCTGATTCGGAACGTAAACACGGCTGCAAAC
TCCTGCACTCCCAGCGTCTTCTTGCCCCAAATGTAGCCGCGTTTACTCTGACGGTCGGGCGTCAAGCGAGTGAAGTGGCGGTTCACGGCGGTGTCTCCTC
CGTACGAGAAATCGTCGCCCAATTGGCGCAATCCCTCGCcgttgatgtcgtcgaaTGGTTTCTCGAATGACACGTGGGAGAGAAGCTTCGCACTGGTAGG
AGAGCTCTGCAACGCTGTCAAGAGCGACACAGCGCAGAGTAAGAGACCTAGAGTGAAGCGAGACACGCTCATAGTCAGG