Description :
From Genome Similarity Track
Location :
Scaffold_1:2541199- 2548950
Transcript NameFunction/comments
Phyin_T30-4PITG_00492Cytochrome c peroxidase%2C mitochondrial
Phyin_T30-4PITG_00493Putative uncharacterized protein
Phyin_T30-4PITG_00494Drug/Metabolite Transporter (DMT) Superfamily
Phyin_T30-4PITG_00495Fat-free family protein

Sequence
7751 bases(100 bases per row)
TTTACTCGTCTTTGCGTCCCTTGGCATTGATGTCCGACCATCGACGATCCTAGAATCTACCACCACTCCCCGGGACCTCCTCATTCGCAATCCTTCCAGC
AAGAGCTCAAGTAAAACCTCGCAATGCTTCGCCGTGCCGCTATCCGTGCCGCCCAGGTGTCCGCCGTCTCCAAGACGCGTGGCTTCGCAACCTCGCAGCT
GCGCACAGCCAACAAGAAGAAGCAGCCGAGCGCTATCGTTCTCGCCGCCGCAGGCGTCGCCGCCGTGAGCGGCCTGGCCCTAACTGACCTGGTGAACGCG
CGCGAGAAGGCCGTGGACCTGGACGCCATCAAGAAGGAGATCATTGATATCTTCGACGAGGACAACTACATGGGCCCCACCATGGTGCGTCTCGCGTGGC
ACTCGAGCGGCTCGTACTCGGGTAAGGACAACAGCGGAGGCTCGACGGGTGGCACCATCCGCTTTGACCCGGAGATCAACCACGGCGGTAATGCTGGTCT
GCATCTGGCTGTCAAGGCCCTGGAGAAGGTCAAGAAGAACCACCCGGAGATCACGTACGCTGACTTGTACATCCTGGCCGGTGCCACGATGATCGAGGAG
ATGGGAGGCCCCGAGATCCCCTTCCGTCTCGGCCGTCCGGATGCCAAGAGCGGCAAGGAGCCGACGCAGACTCCCGATGACCGTCTGCCTAACGCCGACA
TGGGTAGCAAGGATAAGACCACGCAGCACGTGCGCGACGTATTCTACCGCATGGGCTTCAACGACCGCGACATCGTGGCGCTCGTGGGCGCACACGCTAT
TGGACGCTGCTACCCGACACGAAGTGGCTACAGTGGCCCATGGACTAACGCCGAGTGGACATTCTCGAACGAGTTCTTCCGTGAACTGATCGAGAACAAG
TGGACGATTAAGAAGTGGGATGGCCCCATGCAGTACGAGGACCCGACGGGTAAGCTTATGATGCTACCTGCCGACATTGTGATGATTCAGGACCCAGAGT
TCAAGAAGTACGTCGAGTTGTACGCTAAGGACGAGGAACTGTGGTTCAAGGACTTTTCCAAGGCTTTCGTCAAGCTCACGGAGAACGGCGTCAAGTTCCC
CAAGTCAGGCTGGTTCAGTTTCTTTAGCTAAGTAGCGATTAGTTGAGGGATGGAACCTCCGAGTATTACCTCCTACAGTCTGGTAGCTCGAACCAACGTA
CAGATCAGTATTCTGAAAGTCTAGAATGCTTTAACGTCTAAGTATATAAACAAATACATCATCATGATGTAGCAATAAATCTATTGATGTAAGGGTCCTA
TTTCGGTGTATAGCAGCATGGGTAGGACGGAATCTCGACGTGGTAGAAGGCGTGAAGTGACTTTATCGTACGAGAAGACTTATCCATGGGAGGACGAACG
TGGATCTGCGGTAGAACGCACCGTGGAAGTCAACGCAGAAGCCAAACGCGTGTATACGATGCAAGAGCAATTGCTACCGACACGTCCGCTTGATCGACCG
TTGGATCCCGCAGCGAGTGAGCATCTTCAAGATGTGGGGCGTCGAGTGTTGATCCTTCGAGATACTACGAAGAGAGCACAGATGAATGGGATGCTGAGTC
CAAAGAAGTCTCCGAAGCGTGTGATTCCGAGTCGATATCCTGAAGTTGCACCGGACTTGGAAGAAGATAAAGGAGAACCGGATCGAGTAGAGGAAGAGGT
AGACCCAGTCATTACAGAAGGACGAATCGTAAGTACACGGTAGTTTTAGTACACGTAGTGTGGTGATGTTGATGACAAGCTTGTGGTGGTGTAGACAACG
ATGTTGATGGATCAGGAATGGGATACGCGAGGGTGGAATGCAACAAAGATCCAGGCAGCAGTGGAGGCTTTGTACGAAGAAATTGAACACTCCGACGATG
ATTCACGACGCGAACTTGCAACTTCGATGCTGCTACGTCTGATGGAAAAACACGAAGGTCGGTACGTTAGCGTATCCGAGTCCATCACATTCGTCGAATA
ACATTGTATTTATGCTGAGCTGTAGACGCGGTAGACTACGTCGAGACCTCTTTACCAAGTCTGACTAATAAAGCCTTCCGGACACTGTCGAAATTCACTG
ATAACATCAAGATCTTCCGTATGGCTCGACTTGTTGCCGTGCTAGCGGAATGGTTTGCCCACGTTTTGTCAAACGAAAACGCAGTGAACAAGAGTGTCGG
ATGTTTATTGCGTGAAACCGAGTTATGTGCGCGTATTCTTCAGCATCATTGGCGTGGAGTGCTCTTCGAACGCTCACTGAACAAGCGAGATTGTGATCCG
ATAGTCCGAACTCGACTGCGTTCCATGTACATGATCAAATTCGTAGAGTTACGTCATCAATTTAAAGTATTGCGAGAAGCTATTGGGCCTGGAGGAATAC
CTGACAGCGTCACACAGACATACATCACCATTTTGTATTATTTGGTGAAGCTCCAACGCGGCCCTGACACGATATCAGATAAAACTCGCAACACGGTGCT
TTTGGATCAGCGAAGGACACTTGGGTCAGGCTTGTTGGTGTGTTTGGCGTCTCAAATCACTAGACGCCAGAGCCGCGAAGTGATTGAGTTGGTGAAAGGA
ATTGTATCAAATATCATTGAAGGCCATGGAGACGAGTACATTGTGGAAATACTTCAGTGCAACATCGTCCAGAGAGTGCAACTGGACTTGGTACACACCA
TGGAAACGTTTGATGGCAACAGCGTTGCTGCTTCTACGGCACTGACAACTTCGCTCAGTTTGATATACGCTATTGCCACTAAAGTTCTTCACACGACAGA
GCGATGGGGGCAGCCAATTGTTGCTGCAGGTACGTCTTCCAGTCCGTCTCGAAAAGGAACGCCTTCACCCGTGAATAATCCACGCAACGTTGGAACTCCT
GACGAGCGGAACTTCATGATGCGAAAGCTGAAGACGTCAGTTCGTCAATTTCTACTGACTGCGGATCTTTTCGATACGCTGTTCGAGGTTCTGAGTTACT
GTCAAGAAACAAACGACAGGTTACGAGCCCAAGTGCTGGAAATACTGTGTCTGCTTGCTCGGTCGCTGGGTTTCTCTCAACTTCTTGATTCGATGACTCG
GTGTGGAGGACGATGGCTTGAACTAGTGTTGCTGTGTATGAAAGATACCAACCTGGTTGTTGTGCAAGCTGCAGTGACTTTATTCTACGACATGACCAGC
CGTACTGATGCCCGACACGGACTCACAACAGCAGGTGCTGTACAGTGTTTCATGCGTTGGTGTCGACCCAATTTTGAAGCTTGTGAATCGCGGATGGCGT
TCCTCATGGGACTTATTGGATGCTCCTTACTGGCTAGACAAACGGAGCGAGTCAAGCCTGCTACGGCACTGCTATCATCGCTAACGACCTTCGAGAAGCG
ACTGGATGCGTTGTACACTCTTCTACTGAACCTGGCAATGCAAGATGATACTCTACCACGTGCCTCAGAGAAGACTGCCGCTTTCTTCTTCTCCGTTGAT
GCATTGCCGACGCTTGTGACGTTTTTAACGCAAGTGTCGCCGAGTTGTATGGAGTCACCAGTCCAGAATGCTCGACAGCGCAACGTTAGCTGCATTTTAC
TCGGTCGCATGTGTAAAATTGCGCATTTAACGCGAGCGTGTTTCTCCGAAGGTGTCGTCAATCACCTCGCACTATCGATTCAATGCAATCGACTGGATGA
AATCGAGAATTTGGTGGCTCGTAGTTCGTCTGAAGATCGATCCATCCATGAGCTTGGCTCGAAAGAGGCTTGCAAGGCGCTTAGCCGACTAGCGCGATGT
CCGAGTAACCTGGTGGATGCGCGACTTCGACCATCTATCACTTCCGCACAGGTTCCTGAATGGCCCCAAGCCTTAATTTGCGATGTCATGTTTAGGATGC
ACGTGTTGGAAGACTTGATTGCACTTATCCGAATACCAAGTGATGCGGCTGAGTTTCCCGAGGTAGAATTGGATAAAGTTGTAGCTGCAGTCGAACTCGC
AGGGTATCTTCGACCGCTGCCTTATGGCGTAAGTGCTCGAGACAAGTTCCTGAAGTCTCACGCCCACCATCCACACGGGAGATATGCCCAAGAAAAGCTG
TCGAAGCTTGTTGAGCTGGTCGCACCTGCTATCTTACACATTCTCCGCGAGAAAAGTGCTGGGTTTGAACTTGTTAGTGCGTGCTGCGTAGCTCTCAGTC
GACTGGCATGTACGAATGCTGCGTGCACTATGCTGCTGGCTCAAGGTTGCTTGCAAACGGCAATGATTCATTTACCTGATATCCTCATCTCCACTGGAAC
AACAGCATCTCCGAAGCGACAAACTGTCGTGGTTGATTCATCAGTTGATTATCATGCGCTTCTAGATGTACCTGCCCCTCTTTATACGCTGTTCGGTAAG
CTGTGTGCAGTTGCAGATGGACGAACTGGGGTAATGCGTGCTCAGGTGCTTCATCGTCTTCTCAAGCGAATGCAAATGCAGCATCCGACCTCGCAGACGC
TTAATGACGAATGCAAAAGTGAGATTGCGGTCGTTATTTCACGGTTAGCGATGGTAAACACTGTGGAAGGCAGCTCTGGCGAACTCTTTCTACACTTCCG
AGTATTGGAGTTGCTATCGAAAGTGTTGCAGCAACATCAAAGTCTTGTAGCTACGCAAACTTCTATGGCATCTTCGAAAAAGAAAGACGAAGTGAACAAG
TGGAGACTTTTAGTGCATTCCGTTGGTGCAATTGCAGCGCTCAGTCAAGATGTGCTCGTGTGCGTTCCTCGAGTTGTTGCGCTTGGTATCGTTGAGTTAT
TGTTCCCGTTTCTAACACGACTTCGAGTGGAAGGAGGTTCCAATCCCCTACTTGAGTCGCTCCAGTATGATGCAGTCACTATTATTCGATCTATCGCGTC
GTATCCTTTTGGCGAGTACCATGCGTATCTAACGAACGTAAAAGGTGTTATTCCCGACTCAGATAATGCAAAGGAGAAGGAGAATAACAAAGAGGCAGCA
CCGCCGATGTTGATAATGGAAAAAGTAAAGCAGATTGCCTTCGATTTCGCGATGGAGCTAAAGAATAAGCCGATGGCTTTGAGAGACAAGAAATCCGTTG
GAGAACTCGCTCGGGAGACTATGGCGTTCATCAATGAGCATCAACAACAACTAGAGCGACAACAAGAACAACGTCGCAAGTCTAATGTGAAGTATTTAAA
TGGATCTAAAGAACACCTCACATCGATGACTAGCCCACGCATGAAAAACTCATCTCCAACTCGAGCTTCATTCCCAGTCTTACCAACGTCTCCAATAAGT
CGTTTAAATGAAACTCAGGACCCCTCTCCTGCGCAGAAAGTTATAGCCAGCAAAACAACGATAGAGACTCCGCTTAACGCCACTCGATCCGTTCTTTTAC
TCGACGGGGGATCTAAATCACCAGCAACATTGAACGGAGTGAACATCGCATCAACAAGACCTGCAGTGAACAACAAACCGTGTCCTGTGTCCGAATCGCA
CCACCATTATGTCTTCACTAGACCCAAGTCGAAGACCAAGCGACGTGACAAAAACCCAGCGTACTGTTTAATATTGGATCCGCTTTTCGACTCTGGTAGC
TCCCCTTCAATCCCAAGACTACCTAGCGGCAACATGAAGACGCCAGATGACTTGCAACATCCCAACGAAGAGACGTACAGCTTCTCACAAGAAGTTGATC
GTTGTGGTCATTACGCGAATATCCAAGCGCTGCGCCACAAGAAAGGGGATCGATACTTCCCGTCATTGGGACGTATCGTTACCTCCACTCCTGTATCTCC
CGATCTCTACAAGCGTCCAGCAACTCTGTCACCACACTAACAAAAACACTTGATAAAATGCTGAACGAACCCTCTATTCAAGCGAAGCAAACAAGGAAGA
GGCTATCTCGTCAGCTGCAAAACGTGGGCAGTCGAGATACCTACGGGTTCTAGGCATTGTCATCGGTTTGGCGAGTCGTGGGGTTGCCGTTGGAGCCATA
GTTGTTCCTGTTGGCGTTGCGCGCTAACAGCAGCTGCGAGATGTCACTGCCGCTGCCACTGCGACGAATCATGGGACTCTGACGATAGACCACTTTTCCA
CGACGCTTACGCATGAGGTGCGTCTTCTGGAGTGACGGCGACGCGTACATGGGCGACTTCTCCACAGACTCAGTGCCACGCTTGCGCTCCTCCTTTTCGG
AATGATACACCAGCAATCCCATGACCAGTACGAAAAGAGAGAAGCCATCGTAGATCGTGAACGCCTGACTGGCAGCTTTACCCGTAAGTAGAGGAATCAT
GTACAGTAGATCCGTCAGCGGGAGCCCCACAGCCGATGACACCACAAAGAGAACGCTGCTGCCTTCCTTGAAGATGTACAGCATGAGCTGGTTGTATATC
GTATTGAATACTATGAAGACCAGGAAGACCGCCAGCACACCAGAGTCACATGGCAAGTCCTTGCCGTTCAGCTCCACTTCGTTTCCGATGAAACACTCGT
GAGCTTTCCACAGGTAGGACGGGAAGCCGGCCCAGGGCACTGGAGGATCGCTGAACGCTCTGATACGTACAGTCCATATCGTAGCGAAGCCGATGATGAG
CTGGTAGAAGCTGATCCAAATGTTGGCGTACCAGATATCCAGATCCACGTCCTTGAGTCCGATCTCCTTGTACACATTCGACGCTGCAGCTGGCACCAAC
GACACGATGTAGAGACTGATCCATCCTATACTTGGGTCGGGTGTATTTGCATTGTCTTGACCAGTAAGAGCGGGGATCAGGTTGACCATTCCGCCATACA
GCACGAGGATGGAGCCTAAGATGTGACCGCGTTTGAAACGCGTCTGTAGAAACATGTAGGACAGCACCATGTTGAACGGAAGGTTGAGCTGGTTCAGCAC
ATTGGCCATGTTCCCCCTATCAAGATTGAATCGCATCCATTAATTTTCAAGACTTTAAAAAATATAAGTACAATATATTACTTACCCGATGTGAGGCGTG
GGGAACGCGCCCAGCAGGTTGTAAAGCGTGTCGAACAGCGCCATGAGCATGTATTTGTAGTGCGGGAACTCGCGCATTTCCGGTGTGATGTCATCTAACC
TTTCAGTTAGTGAAAATCTAAAAATCAAAGGGAAAAAGTAGCTGTCTACTCACCGGTAAAGTAAATCTTGTAGCTGTTGTCCACACATACACACGGTTAG
TATCCTAAAACATAGTTATATTGCAGATTTTATCTACATACGCTACAACGGGAGCCGACGAGACCAAAAAGGCGACGGGGAGAATCACGTTCGTAAAGTA
CCACAGGAACTCGGTGTAGTCGTACGTGATTCGTCTACAGTCGATAGAGCCAAACGAACGTAAGAGATCAAGTGCACAAGTGTAGTAAATTGCTGAAACT
TAACTCACGTGTAGAGCACACGATCCACGCAGCGCGCCATGATGAGCAGGCACAGCGCCACCGCCAGCTTGGACTCCCACAGCAGCCGCTTCACGTCCAT
CGTGATGGCCGATTTTGGATATCAAGAACGGGTGTGACGATCCACATTAGATCGAAATTATTTTTCACCAATCAAACCACATCTTAAGAAATTTCAACCA
ATCCAATCGCATTATTGAAGATCCAGAACACTTCGTAGTTCCGCAATGGAGGACCACGGTATGAACCGCATGCAGGAGCTGCTGAGCAGCTACTACGGGC
TGCAGGACCAGGAGAGCAGGCAGGAACAACTGCGCAACATCGACTCACCTG