Description :
From Genome Similarity Track
Location :
Scaffold_77:254066- 255326
Sequence
1260 bases(100 bases per row)
CGACTGTTCGTCTACGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAA
GTCATCATCGTATTGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATCCTC
GATGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACGATCGACTAGAGCTCGAA
GCGACATGCTTTGTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAGGCAGCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGT
CAAGAGGCCTGAAACTCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTAACCCTGACCGTTTTTTGGCTGTCCGTTACGTTGTTGCGTTTT
CACAACAACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGGTTACTGTTCCCTGCGGTACGTGGTACCGCGCTCGGGGCACTGCATTCATAT
GCGTAATGCCCTGTCTTCTGACATCTATTGCATTTCTGCAATTTCTTATAGTTGTTAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGGTCCATTGGTT
CTGGGCCTCCATTTTCCTGTCGTCTCGACGGACGATAGGAATTTGAATTCGCGTGAGCCTGTTTCACGCTGAAGTCCTCCTGTTCCGCAACCCTTATCGC
CTCCTGCAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTTATCAACGTTTGTTGGTTCAGT
GGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTGCTGAATGTACGAGTGTACGAGTGTACGTCACGTTTACTTTGCTTGATTCTCAGGAGTTCAGA
GCGAGCCGTGAACTCCGCTCGAGGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAACGACTCAAAGACATATGGGTCGTGTAACTTAAGG
CCCAAGGCCCATGTCTTTGCACGCCCTGCCAAGTCAATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGTCTTTATGGCATCGTCTAG
TTCCACGAACCATCTCAATAGGGAGCCTTCATCGGCTCCCTTGTACTTTGAGGTTTCAAT