Description :
From Genome Similarity Track
Location :
Scaffold_25:254- 4100
Sequence
3846 bases(100 bases per row)
ATCTATTCGATGTGCCCATCGAACAGGTCCTTCGCGAAGCGAGTTCAGCTCATTGCTGGACACCTGCGTCGGAGGATTCTTCAATTGCATTGACCTGTAC
TGAAATGCAGTACAGGTCCGCGTCAAGACATTCAACGTCTCGACCCTCGACGTCTTCTCCAAGGTCTGCCCGGCAGACATCTCTCGTAGCAAGTCTTGGT
CGGGGACAGAGACTTACGAAGTTTGTGTCGCTTACGACATCATTTTTTCTTCTTGTGAAACCCGGCTTCACCTGTTTCTCGTCCAGGCTCGGTTTTGAAC
GTATTTCCGTTGATGTAACCGTCAACAGATTCTATCGGCGGACGTGAATGATCAAGTTCGACTTGATTGCATTCCTCTTCTTCGTGCAGGTCGGCTGCAC
GTGAGCATGCAAGAATTTCCAGTACTGGACGTCGGTAACCGCCGGCACCGCTTGCCGCGTCGCCACCTCCCGGAGTTGACGCGCTAATGTCTCCTCGACG
CCTTGCGGCGGAGTCCCTCCTCGATATGGATATCAAGTTTGTGTCGACTCCCATGTCCTTGTCACCTCGATGCCTTACGGCGGAGCCCTCCGTGATTGTT
GTCCAATCACAGTCGTGCCAACTCCCCGAGCTGACACACTGACATCATAGCTACTGCTTGTAGCTGGAGTCCCTTGCATATTCGATGCACCAGTTCCCGG
AACTGATGCGCTATCGTCACAGACATTTTTTGTGAGCGAAAAGACTATCTTAGTTAATGCATCGACTCCCTGAGTTGATACTTGCATTGAAGTAGGAAGA
TATCTCAAATCTGAATCCTGATTTGGGACAGACCCAACAACCGCCGCAGTCGCTGTGACTTGCGTGTTAGCACAGGAGGCAAAACCTTTCCGCACTGCAT
CAACGACGTGGTCGGATGCACCGTGCGATGCATGCGATACAGTGGCAAGGTCATCGCTGTCTGTCGCGTTGCGTCCGAAGCGTACAAGCGTATGCTTCTC
GCACTTGTCCACTGAATTATGCCGAGCAAGCCACAGAATACCCAACACTAAGTCAAACTTATCGTCTAGATCCAAGACGATAACGATCTCAACAAACTTT
CGGTGTTTGTACGACGCGCTTCTCCGTCCTAGTGGTGACACCGGTTGCCAACCGAACTTCCAAAACATTTAGAAGTGTTTAATTTCCTCGAAGTTCAGCT
TCGGTAAACTTTCCTGTCGGAGAAGTTGTTCGGCGCAGCTGAGGCTACCCAAGCACGAAAAGAGCCTGCTCTGATCAATCTCACCTTCAGGATGACAAGA
TTTGGCTTGTCATCTTGCTTCGTACAGCGAGAGCGTCTCTCGCTTGGGAGCTGCAGCCTTTATCGCTGCGTGTCCATTGTAGACACGCGTGCACCCGGCG
CCTACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGTGCTATTGCAAGTGGGGTAGTTC