Description :
From Genome Similarity Track
Location :
contig_40:253978- 257046
Transcript NameFunction/comments
g7363.t1PREDICTED: similar to Copia protein (Gagintpol protein) putative

Sequence
3068 bases(100 bases per row)
CGTTCCGAATGTCTGCAGCTGTCATGATGGCTCGCACCAGTACGACTTGTCCATCCCGCTCTCCTCCAGCATGCAGCGTGTCATTTCGACCAGCGTACGG
TTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCACCATCCCCGCGTTGC
AGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAACGCCTCACACACTTCGCT
CTTCTTGCGCAGTGGGTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGCCCGACTTGGATGCAGGAGTGACGGGCCCC
AACACATCAGAGCACACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTTGAAAGGCTTGCGTGCCTGCTTCGCAGTCG
CACACACGCCACACACGGTTCCAGGCTCTGCCAGCGCACCCTTGAGTTTCCCGTCCTTGATCATGGAGTTCAGCGTGCCGAAAGACGCGTGGCCGAGTCG
CCGGTGCCACAAATCCATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCAGCTTGCCTTGCTTCCTGCCCGTCGCCACC
ACTTGGCCGCCGCGTTTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCGTTGCAGCCGTGAGAGAGAACAGGTTCTTGTTCAAAT
CTTGAACGTGCAGTGTGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACTGTTCCAACCCCGAGAATCTTCAAGCTCGC
GCTGCTCTTTGCGCTCGATATGGTGCGCGCAGTCTTTACACCCGAGTACTCTTGAAACGCGTCGCGTGTCTTGCACATGTGTGCCGAAGCACCGCTGTCC
ATCACCCAGCACTCGCTAGCAAAAGCTTCCGTCGCATGGAACGCAACGTTCGACTGGTCTTGGACATCTTCATCGGGACTTGCCTCGGAACGGCAATCCC
TCGCATAGTGGCCAGGCTTGCCACAGTTGAAACACTTCCCGAAGGGCCCCTTCTTGCGCATCCCGCGTGCGTTCTTCTTCTTCTGCTGCTGCTTCCCATT
GCCCTTGCCGGCAAGAAGCGCAGTCGCCTCTTCGATGCGGTTCGAGTCCTTCTGACGCACTTCTTCCGCAATCAGCTTGCTCACCAGGTCTGCAAGCTTG
AACTCACTCACTGACATGCGAAACGCTTGAACCAGAGCCTCGTAGCTCGATGGCAGACTCCGCAGCATCGTCGCGCAGACGTCTTCCTCAGTTGGCTCAC
ACCCCGCGTTCTTCATCTCCATCACGAGCTTCTCCAACTCCGTCACGTGCTTGCCGACGGAGGACGCCGTGAACTTGAACGCCGAGAACTTTTCCTTGAG
CCACAGCCGGTTCGCCATGTCTTGAGTCTTGTGGAACTTCTTCAACGTGTCCCACGCCTCCTTCGCAGTCGTGGACGTCACCACGTGCATCAACTGCGAG
TCATTCAGGTTGAGCACAATCGCCGCGTGCGCTTGTTGCTCCTTCGCCGTCGATCCGGCTTCCCCGGAGACAGCTTCCCACAATCCCTTGGACATCAGGT
ACATCTTCATCTTGTAGCTCCACAGCGAGTAGTTCGAGCCGTCGAAAGGCTCGACCTTGAACTTGGTGTCGGTACTTGGGCTCATAACCAAAAGGAAGTT
GGGCTACGAGCTGCGGAGAGTTGAAAGCTTAGAAGACGGCTTCGGGCCGAGATTGCAAAACCAAAAGTGAGATTGATTGAGTGAGTTTTAGCTGCTAGCC
TGCCTCCTACGCTCTCTTGTCGGCAAAAAGAAAAACGTCCATGTGGGGACTCGAACCCACACCCTACGGATCAAAGACCCGGCACTTAACCCACTACACC
ATACTGCATGACCAAAGTCACGCACACCCTACTCCTACATATGTAACTCTACTATGCACCCACACGCATGTCCACGCCGCTTCAGCACTTGGACACGCTC
CCACACGCTTGTTCTCACGCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCTACAAATCCCCCCGCACACGCGTAGAGGCACGCGCACGC
ACACACGCCTTGCACCCACACCTGGTGCACACACGCACATGCACACGCAGCACCCTCTAACAGAAGAAGGGGCCACGTCTAGGGAGATGGGTATGCATTT
TGTATGGTCCCAGCGGCGGGTGTGTAAGCTGCTTGACTGTGCGCTCCAAGGTGGTGGTGTCAAAGGGAATTGCAGTCGGGCCATTGTGCGCGCCTGGTCT
GCGTAGTACAGTTATACAGTGTGTGTGTGTGGTGGTGGTGGTGGGGGGGGGGTTTCGACGGGCAAAGTGGTGTCGGTGCTGTCATGTTTTTTGGCGGGTT
GTGTCGGCAGGCACAGCGATGCGGATGCATGTGTGTAGTAACGTTCTTCTCTTTTGGAATGCGTCTAGTTGTTTGTTTGTTTGTTGTTTGTTTGTGGTTG
GATGTTGTTTGGATGTTGGTTGAATGTTGGTGTTTGTTTGTGGCGTTTTGGTTGGTGTTTGTTTGTGGCATTTTGAGGGGGTGAAAATTGTGTGTCGAGA
AGTGAAAAGTTACGCCTGTGTGGCTCAGTGGTAGAGCATCTGTCTTGTAAACAGAAGGTCCCGGTTCAATCCCGGGCGGAGGCATGCCTTTTCCACGCTT
CTGTATTCCATCTGTGTCTCAAGACCGACACGCGCGCACGCATAGCCTTGTTGCTACGGTTTCGCGTGTGAGCACACCAGCGCACGACGGTTTCTTGTTG
CTCCGCTCCATCCGTTTTCCTCCACCTTGTGTGCTGGGCCAGGTAGCCTGGCTCTACTGCGACATGTGGAGGGCCGTGGTGATTTTCTCGACGCTGCATC
CGGTCGCACTACATGATTTTCGCCGTCTCTATTACGCACACTACCTGTAAGTCAAATGACGTACCCAC