Description :
From Genome Similarity Track
Location :
Scaffold_1264:2539- 5424
Sequence
2885 bases(100 bases per row)
GTACCGCTTGAGTCACCCGACGTAAAACGTCGGGTGGAGTCTAAGTGACGACGGGATGTCCAAGGTGTAGGCGTCGCCCACAGCCTTGGTTACACGAAAA
GAACCGATGAAGCGTGGGGCAACTTTGTTGGCGCCGAGGTTGGTCACGGCGGAAGCGCGGATTCCAACGGTCGATAGGAGAACGCGATCTCCTATCTTGA
ATACATTCACGTTCTTTCGACCGTGCTTATCAGCTTGTTCCTTTTGCTTGTCCACTGCGTTCTGCAGTGCGTCGCGGACGAACCTTGCGATGGATTGCCT
TTGCATGACAAATTCCGCAACTGCCGAGCGATCGGCAGGAAGCACCGAGGGTTTCGGTGTATAGTTTGCCGTGGTAACTTCTTGCTCACGAATCTTGCGG
CCTGGATCGATCAAGTTCTGCGACGTCCATCTCGTTATCGGAGATGCAGTATGCCGAGGAGGCTCGATGGACTGCTTGGACGGAGAACGAGTCAGGGCGT
TCGCACTGGCTACACCCGAAAATAACCCTGAAGTCGAGTGCGCCGGCAGGCTTGTTGACACCGGTGAGGCTACCGGTGCGTGCTGAGACACCGGTTCACG
TACCGGTGATGACCACGACACGGACACGTTGTCCCTAGAGCTGAGCGCAGCTTCAGCATCCATGTCGACCGAAGGAGGTTCTCCCCCACCAAGGGTGGAG
CCGCCAGCATCGGTGGGGTGACCCACGGCGAGAAGTGCCGGAACACGTGGGTGGCGTGCGTTGTTCACGAAGAACGGCGTCATACCCGTCGAGGAGTGCT
CGGCGTTGTTGAGTGCGAACTCGGCTAGCGGTAGGAACGAGCTCCAGCTCGTGTACGAAGTTGCATAGCTGCGAAGAACGTCTTCAAGGACGCGGTTGAC
GCGTTCTGTTTGTCCATCCGTCTCCGGATGTGCCGCAGTCGACATCAGCAATTTGGTTCCCAAGAGCTCGAAGAGGCGTGACTAGAACGCGGATGTAAAC
CGCGGGTCGCGGTCGGACACGATAGACTCCGGCAGACCGTGGTGACGAAAAATCACGTCGACGAAGTGGGCCGCGGACTCTTCCGCGGTGATTGATGTTG
CCACCGGAACGAGATGGACCACCTTGCTGGAACGATCGACGAACACAAGTACACCCGTGCGCCCGGCTGTATCGGGCGGAAGACCGAAGATGAAGTCCAT
CGAAATGGAGCGCCAGGCTTCCGTGGCGACCGGAAGAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGTTTGACTCGCTGGCAAGTTTTACATGTGCGG
ACCTACTTGCGTACCCACTTGAACATGTGCGGCCAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCAGTCGGGGCGT
CATGATACTCGTGGATTATGCGCGCACGTAGATCAGCGTTTGGGACGACGACTCGAGGTCTATCGAGCCTGTCGATGCTGTACTTGAGCGGATTGCCGTC
CAGTCGATATCGATCGATCTGATTTCGCGTGGTCTTTGATAGGGCACTTAGCATGTCACTACTAGGAGCACGCAGGTGCTTCATGATGGCACCGTATATA
GGGTCATCATCGTACGCTGTAGCAATCTCGTCGCCCAGCGGGAGCATGGGCGTGGTCAACGTCAAGTTGATGCCTGCCACACGCAGACCGCACATTCGCC
GTCGTCCTCATCGGCGAGCTGATGTCCTAGCGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATGTTATTCTTGCCCGGCTTG
TAGTGAACAACGAAGTTGTACTCGGAGAAGAAGGACAGCCAACGGGCCATTCGTTGCGACAAGTGAGGGCTCTTCATCGCTGTCCGCAGCGATGCGTGAT
CAGTGTAAACCGCAAATGACTGTTCACCGAGCAAGTACACTCTGAATTTGATCATAGCGTACCGCATTGCCAGGAGCTCCTTGTCGTGGACTGGGTAATT
CTTCTCGGCTGGCTTCAGTTGGCGCGACTGATAGCTGATAACGCGCTCGTGTTCGTCATCATCGAACTGCATCAGCGCACAGCCGATGGCAAAATCGCTC
GCGTCGCAGACGACGTGGAATGGCTTTGAGTCATCAGCAAGCTTCAGGATCGGCGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTGGTGGT
CGGATTTCCACTCCCAGATCACGTCTTTCTTCAGCAGTGAGGACAGCGGCTGGATCAACCCAGCGTAATTCTTCGTGTACTTGTGCAAGTAATTGGCCAT
GCCAAGCCACTGACGCAACTCAGTGGGGCTTGTCGGCGTTGGCCAAGCACAGATAGACGAAATCTTCTCGGGATCCGCGCGCACACCGTCCTTGCTCACG
TAGCATCCCAACACCGGAATATCCGGTGCGCAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTCAGGT
GTTTCAGATGTACGTCCACGGCACTGAGGTTGCCCTCAGCGCGGCTGTGCACGAAGATGTCGTCGAAGTAGCTCGGCGCGAAGTCTCGAAGCGGGCGAAG
CACATGGGAGACCATGCGATTGAAGGTGGCAGGCGCGTTCTTGAGGCCCTGTGGCATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTACGGCG
GTGAGAGGCACATCAGATGTTCTCATCAGGATCTGATAGAATCCATCGGTCAGGTCGATTGCGCTGTAGATAACGCTGCCAGCCATGGAGTCCAGTACCA
TGTCCTTCCGAGGGATCGGAGTCTGCGCGGGGATGGTGGCATCATTCAACTTGTTGAATGCGTGAACAATACGCCATCCCCCTGT