Description :
From Genome Similarity Track
Location :
Scaffold_5:253882- 261877
Transcript NameFunction/comments
Physo_128574hypothetical protein
Physo_128575reverse transcriptase

Sequence
7995 bases(100 bases per row)
CCAAATAATATTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTCCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACAGC
TGGTTGGCAGAATTCCAATGCTGTGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGG
TGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTGTCTGTTAAAGAGTTACAAGTGA
CTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCCTCAAGGTTAGACGCGCCGAGTCATGGCACGTCAATCAGGAAATTGACCATTCGTCA
ATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCTCAGAAGAAGACCGACGCTGCAGCAGAGGGGAAGTCCTCCGCCGGGA
TAGAGACTCTCTCTATCCCCGAGTACCGCGAGCGTCTCAAAGCAAAGCGAGACGCTCTTGCTACCAAGGCTGCGGCGGGGACAACTCAACCAGAGATTGT
CCTCGAAGGTTCTTCTGTAGTCAACGACGCCGTTGACTTCGAAGACGACGACGTGGAGATGGAAGAGGGCCAGGCCTCTTCTAGCAAGCGCAAGGAGTCT
ATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGATGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCG
ACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGCCTTCAAGCTCTCCGCGCGCTACCTTAGCAGCGCGCGATCCGTGGATGCC
GTCTGCGTCAGAGATCGCAGACCGTGTGTGCAACACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGTATCCACGACGATGCTGTTGCGGAG
GAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTATTACATCGGGCTCTTCCACGAGCTCCGATACTTCTCCAGCAAGAAGATTTCTTCTCGCA
GCAGAGTGCCTGAATGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGGGAACTTCAACAAGAAGCCGGCTGCTTACCGCGAGCGGGTTAAGCAAGC
CCGTGAACGCTTCGAGACATTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCATGTGCTGTGCCCGAAGGCCAA
CAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTG
CCAAGTTCTTGGCACATGAGGAACGCGACGATCGTGGGACCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGAGCGTGGTGA
GCTTCGTACGCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGAT
AACGAACCGGCTGCCGGTTCGTTTTCGGGATACTGTGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCACGGGCGTCACGGATCGGAGGCGGCGG
TGGTGGTAACACGCCCCGGGTATGGTCAACCTGGGGTTGACCTTGGCCCGACGCTCGAGGAGCGAGTCGCCGCTGTGGAACAGCATCAGAGCCGGGAGTT
CGACGCTCTGAAGCAGGAGGTGGCGATCCTGAGGACTCAAGTCGCTCAGGCCTCGCAGACCGCGTCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGCA
CGCTTGGCCCAGCGCGTTCACGCGCTGGAGCGGAGGTTCGCTCCCACTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCCGGTATGG
CTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCG
ATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCAGAAACTGCATCTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATTCAC
TAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTG
CACGAAGTGATTGCGTCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCC
GTTCTTCTTCTTCTTCTTGCTCTTGTCAGCGTCTGTGCCCTGCACAGACGCGTGCTTCTTCTTCTTCTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTG
TCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTTCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGACGTGGGTGCCTGA
TGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGACACTCGCTCCTGTGTTGGAACGA
GTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCTGATGATCCGAAGTTGACATCGAAAGTTGACTC
CCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGT
CAACGAACAGACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGT
GTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATAGACTGCCAACACTCCGACGGAGTCGGCAGTGACTGCAAGGGAGCCTGCGCG
AAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAA
GGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCG
GTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAAGCCGTCGTGCACCCGATAACGATGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCT
TTGTCAGAAGGCGCTGAGCCATAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTATGCGACCTTCACGTCGTCCAACAGTGACGATGTTGGGGTGC
TCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTTTTCCGGGTTT
GTACTCAACCCGGAAGTCATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGG
TCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCCCGAGTGCGTACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGTTAGT
TGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGA
TGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACAT
TCAGCAGTCCAAACCCACTCGATGTCCTTCTTCAGGAGCTGGGACAGCGGGCGTATCATGCCCGCATAGACCTTCACGTACTTGCACAAATACGTGGCCA
AGCCAAGGAACTGCCGCAGTTCCTTGACATTCGACGGTGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCGAC
GAGACACCCGAGCACGGGTATCTCGCTCGCCGCGAAGATACACTTCTTCAGGTTTGCGTAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTTCGGAGA
TGCACCTTGTGCATCTCAACATCGCTCATTCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCAAGCGCA
ACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGC
CGTGAGAGGGATATCGCTCTCACGCATTAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAAATAGTGCTCCTGGTCATCGAATCGATGATG
ACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATCCGCCAGCCGCCCTGTGGCTTCTTGATAC
AGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTTCTCTCGCGG
CAGTGGCCACTGCCGCGTGACACAATACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGCACGGATCTCTTCC
GGAAGTACGTCCGCGTACTCCCGTAAGATTTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCCGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCAC
TGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTG
CTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCAACGCTTGCGTCGGAGGATTAGCGAGGGTC
GTCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGTCCGGCAGACATTTCTTGTA
GCGCCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGCTTTGCGGAGCCCGGCTCCGCTTGGATCTTGACCTCGTCCAGG
CCCAGCCGTAGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGATCGCCCGGCGCTTCGTCGTGC
AGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCAGAGCCGACTCGCCATCTT
CACCTCGACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCTATTACGGAGAGTGCGTCGGCTCCCTGAGCCGACGAATCGAATTCACCCAAG
CCATCGACTCCCTGAGTCGACGGCGTTTCGTCACCTTGGCTCTTATTATTGGCCAAAACTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGT
GTGACTCGCCTGCGTCATCCGTGCCCCTTGTGGTCCGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTC
AGCCGTCGGCGGCGACGCCGACGCTAGCTGCTCTTGCGCGCATGTTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTTGGCGCTGTCTCGAGTGGG
GAGTCGCGCGCACCTGTCGGTGCGTACGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAAT
CGATGATCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAAATTATCGTCCAGATCCAGGACGATAAAGGCCTCGACAAACTCTTGATC
TTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCC
TCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGAAGAGAGCTGCTTGCTCTCATCGAGTTCA
CGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGCGAGAATGAATCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGAC
ACGCGGAACTGCATTACCAGTAGGGCGCCCCACGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCT
GCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCACAACGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGTCCAGCATTT
GCAGCACTCGAGAGGTCCAGAACCCATGCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAAC
TCCTCCTGCATTACAAGAGTAATTGTAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACG
TGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCAGGATGTTCGAGACCAAGTACCGTGCTCTTTGAGCCTAAGTATGGACATCATGCTTGCCCTGCTG
AAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGGCTCAAATGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGCTAAAGCACGTAGG
ATCCGAGAGTCGGCGTCCATACGCCCAACGTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCAACCATCGACAACGGGTCGACGATACGTCGAGCC
GCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGGTTGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTG
TCGTCGGGGACGACACCGTGGTAGACGAAGCAGCATCACGCTGCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCTGTCGGCGTTAGCGTACG
CAGCCTCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGCTGGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACG
TGAGTTGCAGGCGTAGTGGAGCTTTCCATAGACACCTCCGTATTCATGGGAAAGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCG
GTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGT
TTCTTTTAGTTGAGTTAAGTATACGAGAATACTTTAATCGAGATAAAGACTCCAAGTAGCGGATTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTAT
GTTCCTGACTTCCTCTGAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTGTGCATGTCGCTCATTGGCTAAGAGA
TGCTGCTCTCAGCCAATAGGAATCCTAAGCCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGT