Description :
From Genome Similarity Track
Location :
Scaffold_6:2538550- 2544101
Sequence
5551 bases(100 bases per row)
GCAGACCAACACTTTATGATGTGAGCGACGCGTGACCTGGAGGATTTCGTTCCGGACATCGTTGCGTTTTCGGTGGATTTCCATATCGCCTTGTTCGTCG
CGCTGTTCATGTCGAACTCGGGCTCATTCTCGACTTCTGCGGTGATTATCGCTGTAGATTTGGTGCAGTCAGTGCTTGATTTCCGAGAGGCGCGCTCAAA
TGCGAAGCGTGAGCTGCTGCTGCTCAGAACGAGGGATGACTTGAGAAGGAGCAACTATTTGCCAAGATACTGCCCATTATCCACAATTTCAAAGCGTTCC
GCGGCTCATCGCTGGATAAAACACGACTTTGGGCGTGTCTACCTCATCCCGCTCACACGAGAACAAGTTACTTAAGTAAGCTGCTACAAACGTTAGGGCT
GTCAAAGGTATTCAGGGTCAGGCGGCATCATTCAAACAGAGGAACACTCGGGGGCTTCTGGAATTCAAACGTTAAAAGAGTAGGCGTGGCATCCCCGACG
CAAAAGTCGTTGACGTCTGTCTCCCTGCCAGATACTGAAGACACTAGCCTATGAACTCCTACCAAGTCTATTGAGAACTCGAAGAGGGTCCTCAACTGCT
ATTCCATTGTGAGTATCTCGTCCTTGTCGAGTACATCGAGTGCATTGTTCCGCTCGGCTTCGCCATCTACAGGTCGACAATCAAATCTCTCCCAAACATG
GCATTTTATCCGCCTGATGTAGGCAACTGGGGGGTTAACTGGCGTTGCGAATGTTCTGGTGTTTGCATTGATGGAGGTTCTGTCCTTGATTCTTTTCGAG
CTCTTCTTCCGCCGCATATTCGCCTTTCTCCCCATGTACCAGCTTGCGTTCGTGCTCGAGACTCAAGTTTACTGGATACAAGGCCGATTGTGGGTTATCA
CGCTAAGCCAGATGCAGTTCGAACTTGTTCACTCTGGTAAGGTATTTACTTGCATATTATATTGCCAGCTTAGTTATTTTTCTTTCTCTAACGGATACTT
GATCGTTTTGCACAAGCAGGAGCTGATTACACATGTCGGCTCGAATGGCTCTATGACCACAGTCATTGAACAATTGTGATACTTACACCAAGCTGATAGA
AATCCTTATCAACACACACGAGCTTTTAGATTTAAAATCATATCTTAACAAATCTTGCCCCTGTATATATTCTAAATAAATCGATGTACATGTTGTCCTC
AGAACGAGTATATTTCTTAACAAATATACTTAGTGCGTGTGCTAAATATATAAAATGTGTGAAATAGTCTTAGTTTGCACAAGTATTTCAAGCTTTCGTC
AGAGTTTCGTTGTTCATTGGAGCTTCTTCTGGTGATAGCATTTGGCGCGCTAGTTGACGTGTCGATGATGGGCCGCGTGGAGGAACAGAGAGAGGCTGAG
AAAGCGCTATCACCCACCCGAGTAACTCGAGCAGCTCGCAAGTTCAGCCCCTTCATTAAACTGCTCAAGCGTCTCGAAGATGAATGGGAGAGAATTCAAG
TCGGGCGGCAGGGCTCCTACTCCGTCGAGCGACTTGAAAGTCTGAGTCACTACTGCAAAACCACGTCGCGAACTCGTGCCATCTTGGTATGCGTCGTCAC
CCCACTCCCCGCTCTATCCGTGGCTCTCTTGCTCGAATGCATGCCCCTGCGACCGCCGTCGGAGGGCTGGAGGGTCAACTGGGTCTTCTGGATTCGCCTC
GCAATCCTGATCTTCATCATGATCTTTGCTATCCTCTCTCAGCTCGTCACGTGCGTTCCAGAGCTAAACCCCACGTTAGCGAAAAGGTTTTCCGCCGCGG
TAATTGCGGCTGGCACCTTTGTTGGAATATGTGTCACAATAGCGGAAAACTACGGCTTCCCCATTGCGTTTATGTGGAACATGGCAAATTTACTCGGAGG
GGTTTACCTCCTCCTGGCGATCCGGTTCGTCTTCGGCGGCAAAGTTTTTGGGAAAGACTCGCCTCTATCGCTATTTCTTCGCCTACATGGGGATCGGAGC
GGTGTACCCCATGTACGAAGGGGTATACCTCAGTGTGTCCGAAAACTACCGCGCTGGTGTGATCCTCGCCCTGCCATTGTGGAGGTTTGCCGGCAAATAT
TTCGTCAAGTGGGCGGCGTACGATCTGGAGGATTTATCCCTGGAATCGTGACTTTCTCAGTGGATTTCTACAACGCGCTCTTCGTATCCCTCTTCATGTC
AAATGCGGGCTCGATGCTCACTACCGCGCTATTCATTGCAGTCGATTTGGCGCAAGTTATCCTGGAGCTTCGCCAGGTGCGGACCATGTGCTAAAACTTC
TTCATGACCGCCGAGCCTCGAGAGAGGAACTGTGCAGAACCAACAGCGACTTAGAGAATACCGGACTGGTGAAGATCGTACTGGGGGTGACTAACAACCT
CAGTGTATTATTCGTGACGCCGTTGAAAGCCGTCCGATTGTGGGCGTGTCTGCCTCATCCGCTAGGCAGCGGCCAAAAGGAGCAACTTTACGCGTGGAAA
TCGTCGGGTTTGTTTGTTGCCCAAGCAGAAGCCAACAATTAGAAGAAAATCTACTTGGATTTTCTGGAAACCAAGCCGCCGGCGCATTGAAGTCGCCCCA
GCGCGCAATCTTGAGGAGAAATTTACTGAAGCGCACAAAAATCTGAGTCCCAGACTGGCGGCATCAATTGAGAGATCCAAGAAAATCCTAGCTCAGGGCC
TCCAACTGCTATTCCACTGCGAATATCTCGTCTTGGTCGAGTACGTTGAAGTGATAATTCCGTTGGTGTTCGCGACCTACAGATTGGTGCTCGTCCACCT
GCCAAACATCGTGTACTACCCGAGTAGTATCGCCAACTGGGGTCTGAGCGCTGTTGGAAACATTGTACTGTTTTCCGTGTTGGAGCTCGGCTCGTTTGCG
TTCTTCGAGAGTTTTTTTAGACGAACGTTTGCGTTTTCGTCAATGTACCAGCTCGCATTTGTGCTGGAGACGCAAGTTTATCTCATTCAGGGAAGTATCT
GGCTCGTCCTGCTGAGCCTCATGCAACTGGACCTCGTCCACTCCGGTACGACGCTATGTATTTTGTCTGTTGTGCGCTCGAATACGTAAAAAAATCTAAC
TACTGTACATCCCGTCACGACAGGAAATTCATCGTGAAAACTACATACACTAGCGCCTTGTTGGCAGTGAGGTATTGCCGTTTGCAGATATTTTGGCCAA
CGCATGCTTATTATCTCGTTAATAATCTCGATTTTAGTCTAGCAGGCTCTTAATTAAGACCTAGGTCTGATTTATATATATCGCCAGTACAGGTCTAAGA
TGCAAGGTTGGGGTCTGTTTCATGCTTTGCTACGACTTGGAAACGCAGAAATGCCATTCTAGACGGGCCAAACCGAGTTTCTGCGCCTAAAAGCGGCCCC
CACCAAAGCATAAATCTAAATCAGCCCTCGCCTATCTCGTGTCCACTCATATTAAGACAGGCGTGGTCTATTTTAGAGATCTATTTTAGAGGGCTAAATA
TTTGCACATGTACTGCAAGATCGCAATGACGAATACCTATTACAAGTATACATGCTTTAGGTTGAGCTTGAGACCTGCGCAGATGTTTCTCGCGGTCATT
CTTCTGCAGGGTCTGCAGGGTACTTGCAAACTGTCTTTCGACATCTTCGAGCCTCGAAGACGTCGAAAGACAGCTCCGAGCCCAGGCGCAAAGTGTCACG
CACCCTCCCGGTCGGGATCGGGTACCAGCGGGCTGATTGGGGAGTGCGGCCTCTGAGTGGGGCGAGGTCGGAAAGAGCTGGCTGGGTAGAAGTAGCAGGA
GCTGAGCTAACGTAAATGAAAAGTGTCTCTTGGTTAGCTTGTGTTGTTATCGGGAAAATGCGAGACTGAAAGAGCTAAGCGCCCGTCGGCTCTGGCCGGG
AACGCTCATAAGCACGACGCCTCCTCTCCTCTCCTCTCCTCACCTGGGCACCCTGGCGTGCCATCCATCCTTGACGCGACCCCCTCTCCACTAAGGCTTG
AACAGAACCGCCCGGCCGCGCGACCTCCCTCCGCGACGGCTCCATGCTCCTCACGGAAGCTTCCACGACGACCAGCTGGCCTGACTTCAATGCACCGCGC
CATCAATTCGACAGTGGCTCCTCACGCGAGAGGACGCTGTACCGCAGACTTGGTACCCAAAGTGTACCCACTATCGACCGTAGCGATATCCAGCAGCGGA
GTGGTATCGAAGCAGGCTCGCCAGCGACCCTCCTGGTTCGTGGGTCCCAACCCCGGGTACGGGAAAAAAGGAACTGAAGAGCAAGAAGGGGCTTTGTGAG
GTTTTGCTCAGGTTCGTCGATGTACTATTCCGTTGCCTGTTCGCAATCGCAAGGCCACCCGCTGGCAATGCTGCAGTGCGATCTTCGGCGACGGATCTGC
TCCCGGATCTGAAGTTGAAGCGGCAAAGCCCGCGAGCCGATCAGCACCAAGCCTTTTTCACGGCCCACGCGCTCGAAATACTGCTGTTTTTCGTCTCGCA
GATCTGGGATTCGCGCCGACTGTCGTCGACATTATTGAATGAGTCAGGCCCTGGCCCCCTCGACCTTTTTGACGAGAAGAACGCCGGCACAAGTATTGTG
CCACAGCGCCCAGAGCTCAGTCGTCCATTATTTTTTAAAAGGTTGTATGCATTTTTCTTTCTCTATTCGCGCATCTTCCAGTAGTAAGCCTTTCGCGGCT
CGCCACCGGATCCCGTAGAGGTCATTTTGATCGACTATGCGACCGCATTGCTAAGATAATATCGATTACTCGAAATTTTGGCTCGCAAACGGTCGAGGAG
CATAACTGCAGGCTCCACTATTTGATCGCTTCGATGTCGTCGCTAACCCCCCCCCCCCCCGCTACGACTGAGTACGCTGTAGAAGTGAGTTTTCGCCAAT
ACCCGTCGTGGTGCCGATCGGATGGCCCCCTTGACGAAAGTCTATCCCTGCGTGGGCACTTTGTTTAACGGCGCTGCTACATGTACATGTAGTGAAGGTA
GCCACTTCAAGCTGGGAGCTTGAAGCGAAGTAGTGTACCAAAGCAATGCATCATGCCATCCACGATTTCGCGACTCTCGAAGTCGACAACGCTGTGAGCG
GCGGGCGACTCCGACCAAACCTTTCGTCCGTTCAGAGGTCGTTTTGCCTTTACGAACGCATGGCAGTGGATATTCACGGATATTCACGACTGTCTTCGCG
TTATTGGGGGTAGTCAGCCGTGTAATGAAGGTAGGCACATGCAGGTAGGTCGATGCCTTCCCTCTGCAAGAATTCAGCGACCCGCGTGCTCTCTTGCCTG
GGACAAGCAAGCAGGGGGGTAATACAGTACAGTCCACGCAATGCCCTATGGCACGACACTGCTGCTGTTAGTGCTCGGTAGTCGTGGCCCGTTGCAGTTT
TACACGCAGTAATGGCTTGGGCTTGTGGCGCTGGCCTGCGAACCGTGGTGCTTGGAGTATCGGAGACGACAGTATCCATGTAGGAGCCATCCTGAGCTCT
CCTTTGGCACCGAGTCCCGCTCCGTGCGTTGCACTTGTATTATACGTGAGG