Description :
From Genome Similarity Track
Location :
Scaffold_1004:2538- 11796
Sequence
9258 bases(100 bases per row)
TTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACAT
CTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCG
ATGCAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGATAGTATTGTCGTGCCACCGACACTCCCAATTTACAGTACTGGGTCTGGAAACTG
CGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTACCCAGCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACGCTTCT
CGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACCTTGCTGATCCAGGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAG
ATTCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGGATGGGCCATC
CAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGC
ACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCTGAGGAGGTGTCGGAAGAGCCTGTGGCCG
GCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGAGTCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCGTGGCT
GGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCTCGAGCCTTCACGTTCACAGGGGCTTCCTGTCCTCGG
ATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTTATCCTCAGCGGCGGATTCGT
AGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACAACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGAACTTAACTCTGGCAAAGAGGTCCCG
CGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGACCC
TTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGGTAACTTGGATCTTCGATCTGACGTGGATTCAGGATCTGCATGACAGGATCTT
GATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCAAGCTCCTTGTCTGACCAGCTTGACCTGGATCCAGCTTGGTCTTATTCCGACTCTGG
AGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGCGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGT
GAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGG
GAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCAGATCTTGTTTC
ATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTAAAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCAGAAATGCATGCGAAATTGACTGACTTCGGCACGACACGCTACCGATCGATAGATGGAACAATGACGATTGGGGTAGGAA
CTGGTAGGTGGCTCGCACCCGAGATCATCTCGGGGAGCACCGAGTATGACCAGCGGGCAGATATTTTCTCCTTTGGGGTACTTCTGACCGAGATTGATAC
ACATAACCTCCGATATTATGACGCCGTTTGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGA
CATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTTTATGACATTGCATTTCTATAGGTAACTGATAGTTTGT
ATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACT
GCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTTGGTCAATCCA
CGCCATCGCGGGTAGACTGCCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAG
ATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGG
GCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGG
GAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTTGCACT
CTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCC
GAGCCGCGTTCCTCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAGGCGCGAACTGCACGAGTATGTGCAAGAGATAC
GGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTAGGCCCCGCACGCACCCAGCT
GTTCCGGGTGCAGTCAAGCACCCTTGGAGAGGCGATTCAAGTGGCTCTTCAAGAAGTGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCT
GGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTACG
GGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGAAACGCTGGCAGAAGCCAGGATC
CCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACAGGG
ACTTAGCCCCTGAGAGTTTTCGCACTCTCAAATCGGCGAAGCGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAG
AATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAGCAGCAACAAGTTGTCCGATGCTTTGATAGAAAGCAAGGGC
AACGGGACGGTGTCAGTACGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAATGTCCAAGTGGATCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTC
ACTGTTCTTGATATAAATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCA
GCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGCTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGG
CAGATGCTTGGGAGTCGTCGACGTACATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTAGGTAACATAGGTCCG
CAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAGCAGCGTGTTCAGAGTTATAAAGAGTTCAATATACGGTCGCGCAGACC
ATAACTGAAGAAGAAGACGGCAGGATACGTCTCTTGTGGGGATAACACAGTGCCACACGCCGGTCGCCACGACTATAACTTGAGGAGGGAAGGTGTAGAA
CACTTCTCTCTGTGGTGAATAACAAAGGCGCACACACGCGGGCCCCCCCATATCTTTA