Description :
From Genome Similarity Track
Location :
Scaffold_1634:2538- 6767
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1634-snap-gene-0.2Rap guanine nucleotide exchange factor (GEF) 4
Pytar_ATCC12531maker-par_contig_1634-snap-gene-0.4Conserved gene of unknown function

Sequence
4229 bases(100 bases per row)
GGCGAGAAGGCCCAGCAGGTCTACTTTGTCGTCCGCGGCGAGCTGGTCGTGACCAAGGAGATCGTCGAGCCCGTCTCGGCAAAGACCCATGTCGTGGTCG
TCGAGCGCGTCGGACGGGACCGCGTTGTCGGCGACGATGCGTACGTTGGCACTGGGACTTGTCTGCTTCGCTGGCTGTGATTGACACTGTACCTTCTACT
CTTCACCACTGTAGCGCGGCGGGGGCGAATTTCAACGAGGTCATCTACCGCGAAGTCACGGTCACGGCGAGTACGCCGGTGGAGCTGCTCGTGCTTTCCA
AGTACGACGTGTTCCACCGGCTCTCGCGTTCGGCACGAGAGACGCTGCGCGCGGCCGCGCAGTGCCACGTCGAGAGCGTCGTTTACCTAGACCGCTTCTA
CAAGACGACCAAGTGGGATGCGTACAAGCAGAGACTGCTCAGCGAGCATGTGAACCACGACCGTATGCAAAAGCTGTTACCTCATGTGGACGGCACGTCC
ACTAANNNNNNNNNNGCGATGGCGACTCCACGGACACCCAGAGCTGCTACGGGCAGGAAGGAATCGCCAGAGACTGACACGCCGTTGAGGCTGAGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTCCTCGCAGCGACTCATCGTTGCATGCCACCACGGCAAAGG
AGCTCGTGGACGCCAACGAGTTTCTGCTGCTTGACCCTGTGGCCGTGGCCACGGCCAANNNNNNNNNNCTTCCCGCCGACACAACGGACGCTCACGCAGC
ACGTGCACGCGTTCAACGGCGACGCGCCGCCACGGCCCCGCTCGAGGGAGCGGCAACGGAGACGTGCCGTGACGGCCGAGCAGCGACGCCACGTGGACAT
GCTGAACGAAGGGAATCCGCTCGCGTATTTTGACTTGGACACAGTCCAGGCCCAGCAGCGGCAGCAGCAGGTCCAAGTACGAGGCCGCGCCGCGAGCTCT
CGGCGGCTGCTGATGCGCGCACGCGCACCTGGTGCTAGTGTCACGACGCCGCCGGGCTCGCCCAGTGGGAAAGGCAGCGGCGGGGAGAACAGCGCGTTGA
CCACGGCAGACACAAGTGCACAGCACGCCATGAACCAGTTCTTCCAAGACAATTTCATCTTCTCGCAGCCCAAGAAGCCCGTCGAGACCAGCAGAGAACG
GCAGCGGCGAACACGGCAGAAGGATCGCGGCTATCGATCTCCACCGGGCGATCTGGACTCTGACCGGCACAAGCGAAAGAACACGAACAAGACACCAGTG
GTGCCACCCGCAATCGGCGAGATCGAGGTCGCAAGGCAGGCTGCCGAGGAGCTCTGCGTGGGCGATATGGTGCTCGTCGACATTGAGCAGCTGGACCCGA
GCGGTGAACCTGTGGCGACACCGAGAAATTCCCCGGCCATCCGCATTGTGCGATGCTGCGAGTCACTCGAGGCTGCCTCGCTATTGCCTCCATTAAGCCA
AGGTGATGGCGATGCGTCGTCGGCCCTATACGTGCTGCCCAAGCGGAAGTTTGCGCTGCTGCCACGAGCCACGCGGTCTCAGGCAGCGGAAGAGGCGCAG
CAGCGCACCGTGGCCGGTCGCTTCCTCCGCACACCATCGGCGTCGACCGCAGTGCACCCAATCGACCCCATCGCCACTTTTGCCTCGTTTCAAAAGCTCT
CGAGGCCACCAAGCGACGGGCGCGAGCCGACTGCAGCGCCTCGTGGCAATGCGAACGTGACCGTCACTGCTGCTTGTGCTGACCTACCAACGCGCCGCCC
GTACACGTTCAAACCATTTGCGTGCGTGAGCATTGTGCTCTCCAAGGGCGAGCTCGAGGCGGCGTTCTGTGATGAGCCGTTTCTGTGCGTCCAAGCACTG
TACCCGACCGAGGGCGAGGCCATGGAGAGCGCGCTGCTCATGCCGCCGCAGCCGCTGAAGAACGCGCTGCTCTGCATTCTACCCGTCGGTGAGTGGCTCC
ACTTTGATGACGCCTATGACTGGTGCGTCCAAAACGAAACGGACCGACGTGACAAGCACCCGCCGCAGCCGGCACTGGTGACGACGCCAACGCAAGCAAA
GGCACGCCGGTCGATCTGCGAGCCTCATCTGGCGAGCGATGACGATTCACCGGAGCCGTCGCGCGCCGGGTGGGAGCTCGAGAAAGAGAAGGCACGTCAG
CTTCACAAGTTTATCTGCGCGCGCATGGGGCCTATGAGCAAGCCAAGCCACGACAAAGCCCGGCAGCGTCGAGGCGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCGACGCCATGCCGGCCACGAGTGGCTTCACGCTCGAGGACAAGCTCGCGACGCTTCAGGAGTATCTGGACTCGACCTCACAC
ACGCCGCTCGGCGGCAAGAACGCCGCTCCTCCTGCGCAAGTGTCGATCCTGGGCAAGTACCGGCAGATGAAACGCTTTGGCTCGATCATGCGCTCTCGAA
TCAGCGCCGCGAGTCCTCCTCTCTCGGCCGCCAGCGGAGCCAGCGGATCCACAGGACTGACAGGCGTTGTGCCCGGCGGTGGGTGACATCAATCTCGCAG
TGACTGTGCGTGGAAGTGGCGGCGCCACAGAAGAATTGACGTTGAGTTTAAGTGGAAAGTGTTCGGTCACTTGATCACTATATTTCACGGCTTGCGATCG
AGTTGATTATGGGCCGTCGAGTATCGAAGAACGTCGTCATGTCATGCAGTTTGCGTTGAGACGACGTGCGTCCACTACAGTGTGTGACGGCTCTTTCCGA
GACCACACGCCTCGCGCGTTTCCGTGTAGTGCTGCACCCACCGGCGGAATTCGGTGGGTGGGCGTTCCTCCAGCTTGAGGAGTCGCTTCTCGCCCACATC
GAGGAGCTCACGGGCTTGGCTCATCCGTCCGAGCGACGTCAGCAGTTGGGCGGTGCCGGCTATGAAACCAAGGAAAAAGTCCTGTATCTGACACATGTGG
CGTAGTTTTTCCACGCTTGGGGCGCCTGCCGCCAGTGGGAGAACGGCGGCTTTTGTGTGCGCCGAGCGGTCCAACTTGTTCATCAAGTGGATGGCGTCGT
ATGCGCTCGTCGCAAACTGGAGCCGCAGGTCTCGCGGCGTCGCGTTGAGGCGATCCGGGCGTCGCGTGTAGCCGACAATCTGCTGGACACGATCCAGAAT
GGCCACGGCGAAAGCCGCCGCAGCTTCTTGCTCATCAGTGGGTGGATCGGCGACACGCTTCAGCTTTGCGAACGCATCCGCCAGCACAGCTTTCGACTGC
TCAAACGACGCGAGTTCTCTGTCAAGCTTCTCGACGACCCCTGCCGGGAGCATCGGCGAGCTGATATGAAGATCGTGAAGCAGACTTGTCGCTGTCTCTG
TCTCGCTCGCTGCTGGCTGCGTATGGACTTGGCCAGTTACCGCCCCGCCGTCGGCTTCCACTGGACTGCGTTCGACCGCCTTGTTCCGGTTCCTTTTCTG
GTTCTTCTTGCCCTTCTTCTTGACGCTTCCTCCTCGTGAACTGGCAGCCGCTGAAGAGCTCGTAGTGGTGGCGCTTCGGCCGCCAACAGCAAATTCCTGA
TCGCGCTGTCTCGCCATCGAGCGCCGCACGCTTTCCGCGTTCTGCTCGTGCATGTGCCGGAACAGTCCTTCACGATTTTGCTGGTGCGAGGCGCCGTGCA
TACGCTCCTGTTTCACCGTTTGCTCGAGAATCTCGCGCTTCCATTCATGATTGGTTGTGAGATCGCTCAAGCGCTTGCCATCTCTCGTTTGTCCACGAAC
GTCGGCACCGAGAGTAACCAGCATGCGGTACAGAGTGCGGTGCCCGTTTCTCACAGCCAAGTGCACGAGGCACTCTCTCGTGTGGTACGTTGGTGTGTTG
AGGTCTCGCATATTGTCGGCCTCGAGTAACAGCAAGACAATCTCCATGTGACCCGCGGCTGCTGCACTGTGGACGGCCAATTGGTTGATTCTCGCGCTCT
GCATGCTGGAAATGCCACGGTCCGAGCGGAAGTGGCCCGCCGGTTGCCAATAGAGACCGCCCATCTGAATGAGCCAGTCCACGAGCCCCAAATCGTATCC
CGGTCCGGCGGCCACAAGATGCAGGATCGTCGCCAACTCGCTCGTGACAGAGACCATGAGCAAGAGCTCTGGGTCATCTCGAATCTTCTTCTTCAAGTTA
CGGATGTCTGCCTCAGTTAGCGGCCCCGG