Description :
From Genome Similarity Track
Location :
Scaffold_5:253759- 255171
Transcript NameFunction/comments
Physo_128574hypothetical protein

Sequence
1412 bases(100 bases per row)
TGTAATGGGCCTACTTTGGCCCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCCTAGTTTAAATTAGAGTTAATTATACTCGAGT
ATAGATTAATCTAAATAAACGATCCAAATAATATTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTCCTGACTTCCTCTAAATGTAATATTC
TAAGATAGGAATCTGCCAACAGCTGGTTGGCAGAATTCCAATGCTGTGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAG
TCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGT
GTCTGTTAAAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCCTCAAGGTTAGACGCGCCGAGTCATGGCACGTCA
ATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCTCAGAAGAAGACCGACGCTGCAGC
AGAGGGGAAGTCCTCCGCCGGGATAGAGACTCTCTCTATCCCCGAGTACCGCGAGCGTCTCAAAGCAAAGCGAGACGCTCTTGCTACCAAGGCTGCGGCG
GGGACAACTCAACCAGAGATTGTCCTCGAAGGTTCTTCTGTAGTCAACGACGCCGTTGACTTCGAAGACGACGACGTGGAGATGGAAGAGGGCCAGGCCT
CTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGATGCTTCGAGCTC
GAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGCCTTCAAGCTCTCCGCGCGCTACCTTA
GCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGTGCAACACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGTA
TCCACGACGATGCTGTTGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTATTACATCGGGCTCTTCCACGAGCTCCGATACTTCTC
CAGCAAGAAGATTTCTTCTCGCAGCAGAGTGCCTGAATGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGGGAACTTCAACAAGAAGCCGGCTGCT
TACCGCGAGCGGGTTAAGCAAGCCCGTGAACGCTTCGAGACATTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTC
CATGTGCTGTGC