Description :
From Genome Similarity Track
Location :
Scaffold_1130:2537- 10075
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_1130-abinit-gene-0.10Dynein heavy chain
Pytir_DAOMBR486maker-pir_contig_1130-snap-gene-0.3Holliday junction ATP-dependent DNA helicase ruvB

Sequence
7538 bases(100 bases per row)
ACGCTGGCCGCTCATGATCGATCCCCAGGGCCAGGCGAACAAATGGATCAAGAACATGTACAAGGCGGCCAACTCACTGCAGATCATTAAGCTCACGCAG
AAGGATTTCTTGCGCACGCTCGAGAACGCGATTCGGTACGGCGCCCCCGTGCTGCTGGAAAACGTCGAAGAAGACCTCGATCCGTCGCTCGAGCCCGTGC
TGCTCAAACAGGTCTTCAAGCGCGGTGGCCAGTTCCTGCTGCACTTGGGCGACAGCGACGTGCCTTACAGCGAGAACTTCCGCTTCTACATCACCACGAA
GCTCGCAAACCCGCACTACATGCCCGAGATCTGCATCAAAGTGACGATCATCAACTTCACGGTCACGCGCATGGGGCTCGAGGACCAGCTGCTCGTGGAC
GTCGTACGCAGCGAGCGCCCCGACCTGGAGCAGAAGAAGAACGAGCTCACGGTGAACATCGCCGCGGACAAGAAGCAGCTCAAGGAGATCGAGGACAAGA
TCCTGTACATGCTCGAGAACTCGCAGGGTAACATCCTGGACGACGAAGAGCTCATCGACACGCTCGCGCACAGCAAAGTGACGTCCTCGGCGATCAAAAC
GCGTATGGCGGAGGCTGAGACCACGTCGTTGGAGATTGACCAGACGCGTGAGGGGTATCGGTGCGTGGCGATCCGCGGCTCGATCATCTACTTTGCGATC
GCGAGCCTCGCGCTTGTGGACCCGATGTACCAGTACTCGCTGCAGTTTTACCAGAAACTGTTTGTGATGCGTCTCGAGAACTCGAAAAAGTCCGAAGTTC
TCGAAGAGCGCCTTGACATTCTAACGAACGACATCACCGTGTCGATGTTTGTGAACGTCTGTCGCGGCCTGTTCGAGAAAGACAAGATCGTGTACGCGTT
CATGGTGGCGTCGAGCATCCTCCTGCAGCGCGGCGCGATCAACGCGAGCGAGTGGAACTTCTACCTGGTGGGCGACAAGCGCAGCCCCGCTGCCCAGAGC
GCACTCGCAAACGCCAGCGGACTCACGCGACCGTCGTGGCTCTCGGAGCGCGTGTGGAAAGTGCTGCTGGGGCTGAAAGAGATCTCGCCGGCGTTCGACC
ACCTGGCAGAATCGGTGATCAGCCAGTCAGACGGCTGGAAGAAAGCCATGGTGCTCTCGGATCTGCCCCACGCCGAGCCGTTGCCGCAGCCCTGGGAGTC
GAAGCTCACGAACTTCCAACGTCTACTCGTACTGCGTGTGTTCCGCGAAGAGATGCTCGTGTTCGGCACGCGCGAGTTTGTCGGACGAGAGCTCGGCAGG
TTCTTCACCGAGTCGCCCCCGTTCGACCTCAATGGCTGCTACCGCGACTCGAAACCGGAGACGCCGCTGATCTTTGTGCTCTCTCCTGGCGCGGACATCA
ACGACTACCTGCTGGAGCTCGCCAAGCAGGAAGGCAAAGAAGGCTCGGGACTCAAGATCATCTCGCTCGGACAGGGCCAGGGGCCGATCGCAGAAGCACT
GATGAAGCAGTCGAAGGGGACGGGCGACTGGGTGTGTCTGCAGAACTGTCATCTCGCGGTTTCGTGGCTCGGAAGACTCGAGCAGATCCTTGAGCAATCT
CAGAGCGAAGAGATGCACCAGGAGTTCCGACTGTGGCTCACGAGTATGCCGAGCTCTCGTTTTCCTGTGCCGATTCTTCAGAATGGCATCAAGATCACGA
ACGAACCTCCGAAGGGCATCAAGGCGAACTTGGGCCGAACCTTCCTAGACATGAAGGAGTCGGATTACGAAGGCTGCACCAAGCCGCGCGAGTTCAAGAA
GCTCGTGTTCGCGCTCGCGTTCTACAACGCCGTGTGCCTCGAGCGCCGCAAGTTCGGCGCGGTCGGGTGGAACATCCCCTACGAGTGGATGAACAGCGAC
CTGAAAACGGGCATGCAGCAGGTGCGACTGTACCTGGAAGAGCAGGACACCGTGCCGTACGTGACGCTCAATGTCATGGTTGCCGACGTGTCCTACGGCG
GCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGACAAGCGCACGAACTCGAGCGTCATGCGCAAATTGTTTTGCAAAGAGGTGATGGACGATGCA
TACCGGTTCACGTCCTCGGACACATACTTTGCGCCGCCCGAGGGAAGTCTCGCATCGCTGCGCGAGTACGTGAGCGCACTGCCGACTGCTGATGCGCCAG
ACATCTTTGGACTCCACGCAAACGCCGACATCACGTTCCAGCAGAAAGAGACGAATCAACTGCTCGGCACGATCATGCGCATGCTCGGAGGCGGCGGGGG
GGACAGCGGAGGCGGTGCGGCTGCGCAGAGCAACGACAGCATTGTGATGGAGATGGTCGTGTCGATCCAGGAGCGCATGCCCGATTTGTTCTACGAGAAC
AAGGCGCACGCGTCGACATTCAAAGAGGCAGCGGGCGGGTCTCGAAACTCGCTCGGCGTGTTCTTGTCGCAGGAGATGATCCGTTTTAACTTCCTCATTC
GCGTGATGAAGAGCACGCTGGAGATGCTCAAGCGCGCGATCAAAGGACTGGTCGTCATGTCCGGCGCGCTCGAGAAGATGTACAACGGCTTTCTGATCCA
GCAGATCCCAAAGGAGTGGGAGGAGGCCGGATACCCGTGCCTGAAGCCCCTGGCGTCCTGGATCGAGGACTTCTTTGCGCGCATCGCGTTCACGAACGAG
TGGCTCGTCAACGGCCCTCCACTGGCGTTCTGGCTCTCGGGGTTCTTCTTCCCGCAGGGGTTCATGACCGCCGTGAAGCAGTCGTTCTCGCGCGAGCGGC
AAATCGCGATCGACGCGCTCGTGGTGTCGTGCGAGACGATGGCGAAAGACCGCGAGGCGTACCAGGTGGCGCCGCCCTTCGGCGTATATATCTACGGACT
GTTCATGGAAGGCGCGCGCTACGACCGTAAAGCCATGATGATCGCCGAGTCGATCCCGAATGAACTCTTCGACCGCATGCCGGTCATCTGGCTCAAGCCC
ATGCGACGCGAGGAGTACAAGCCCGCCGACGTGTATGAATGTCCGCTGTACAAGACGTCGATTCGTGCGGGCACACTCTCCACGACGGGTCACTCGACGA
ACTTTGTCGTCGGTCTGGACATCCCGACGAACAAGAGCCCTGACCACTGGATCCGACGCGGCTGCGCGATGCTCTGCATGCTCGACACGTAGAAGGAAGG
AGACTGTGAGGATCGGACGACGATCTAGAGACTGATAGGCACAAAGATAATAGAGAAGACACATTCGACCCTAGGCAAGTAAGTGGTCACAACCCCGTTA
GTGTTGTCAATATTCCATCAGCATCATCATCATATATTTTGGTGTCAGCTCGCGAGTTAGCTGTTTAGCTCTGCTTTCGCCTTGACCAGTTGCGTGATCT
CGCTGTTGGCCTTGACGCGGTCTTCAGTCGATAAGGTGTAGTACGACTGCTGGGTCTTCTTCTCCCACTGCACACACAAACAAAACCGACCAGATAGCTG
TGAGGTCCTGGACACCAGTCACAATCCAAAATGAGGGTCACATCGCACCGTACGTACCATGCGAACATCGCGCACCGAGTGCTGCGGAGGCTGGTACGTG
TGCGTGGCTTTGAATTTCTTGTTATGTCGCGCCAGCAGCGCCTGGAGGTCGTGCAGATCGCTGTTCCCCGCTGCTCTTGAGGACGATGTCGCTGTTGCTG
CTGGTCGCCGTGGCGCATTCTTCGTCTTGCCATTTCTCGGAGCGTTTTCTCCTGTTCCCGCCTGTGTCTGCTTCTGTGCTGCCGCTGCCGCCATCCGACT
GCTTGCAGTAGGCGCCATGAAGCGAGCGCGTGCCTTTGACGCAGATGTACCTGGAACTGACCGTTCTCGTTGCTGACCATGATGCACAGATTCACCGGCA
ACCAGCATCCGCTTTCTCGGCGCGAACGAGTCCGTTGATGAATCGTTTGATCTCACGACAGGATCGCTCGTCACAGCGGCGACTGGCGCTGTCGTAGTCT
TGATTGGCGCTCGCATGCGCACCACGCTCGCAGGCTCCTGATGAGCAGCACTTCCAGTTGGAAGTCCCTCTCCACTGGCTCTCCCTAAAGCAGATTTCCT
TCGGAACCGTGCCGGTGGTCTACACACATAAGAGGACACCCAAACACATCCACAGTTGAGCTAAGCTCAGCATGCACACACCATACGCTTGATACAACAG
AAGCCTCATGCCTTACCCGCTCACAATGGACCCGAGCGCGCTCGTCGATGATCCGTTCGAAAGAGCCGCACGAGTATGCTGGACGTTGTTGTTGCTGTTG
CTACCACCTCCGCCTGCGTTCACAGTTGCACCGTTACTCAAGCCACCGATACCAGTACCCCCACCGGTCGATAGCGTACTAAGCGCTGGCATGACGTTCG
CTCGCCGCTGCGAGCCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTCTCCAGCGCAGCGCTTTGGTTGAGCGCAGTGCCTTTCGT
TCGGTGGTTGGCGCTGCTCCCGCTGGGACGGTGCTTACTGCTTCCAGCACTTGCGCCGCTGCTATTGCTGCTGTTACCGATGGTGCTAGCATTGAGCGTA
CCGCCATACTCTCCACTGTGGCTCTTTTGTTGCATCGCGGCCTCTTCCTGCGCGAGCTCGTAGCTCGGCTTGCTGTGCGCCGCGTGCACCTGGTCGAACC
ACGGGTCGTGTGGGTGTGATGGCAATGAGCCATTACTGTTGTTGTTGTTGGTACTGCTGCTGCTGATGCTCGACGGGAAGTGCGTGTGATACCTGGGCGG
CAGCGTGAGGTCCACGAACAGCTGGGGCGCATCGAACTCGAAGAGCGGGTCGAAGCAGCGCCCCGCCACCACGCTGCCGCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCCGACACGCTGGTGCGCCGCTTTGCCATCATCTCGTTCCGTGTGTTGCTGTTGAATGTTGAATGAGGCTGCCGTTTTTGAAAAATA
AAAACCCGCGCGAAAACACAACACGATTAAAAACTGTAGATTGCTAACGGGGAATGCAAACTAAGTCGCTTGAAGGTTGCTTGAATGCTTATTCAAGCAG
CTGAAGCTGAAGCGGAGGTGAGTGACGGTCTCATGTTCTTAATTGCAGACAAGCTCACCTTTTACCACCAATTGGCCCAGAGCAACTCTTGGAGCTCTTG
TTCCAGCGAGATCAGATCAGGCTCCGCGACGGCTACACTGTAGCTCAACCTTGGACTCACCACAATCTGGCGGGATTCAGTAAATACGATGCAGAGCGAG
TTGTTGCCAGATTATCTGATCTCAAACGAAACTGCACCTCCATCTGCTTCCTTCGGATATCGAGTACCACCAGAACATTGGAGGCTTTGCTTTTCATTAT
CTACTGAGGAGAAGATTAGCAAATGAGCGGCTCTGGCACTCACAAGTTCAATGCAAGCCTTGTTTTCTCCATACTTGACAGCTCAGTCAAGGCGTTAAGC
CAATGGCAAAGGCTCAAGCTACCTCGGAAGAGTCAATCAAGATGAATAAGCGTGGCTGAAGCGCATAGTAGGCAAAGCTGATTGGTTATAGTTAGTATTA
GAAAATGGATGAACGAGAGCGATACTGTGCTATACAATATGACGACGAGCTTCTTCGCTTACATCAGGTACCCGTCGCTCTGCGCGAGTGCGAGCGCTGA
GCGCTTGGCGTCGCTGAAGAGGTCGTTGATTTCCTCGACGTCGTCGACCGCAACGAGCGTGCGGCCCTGGGTCTCGGCGAGGATGCGCGCCGGCGTCAGC
AGCTGTACACTGTAACGCAGCGAGGTCTGCGCACCGATCTCACCGAGACGCACGGTCGCGTCGTCCTCAAGCTTGATGCTCTCGGCCTCGGCGCGGATCT
TGAGGATCTGCACCATCTCTTCGACCGAGTACGGCATCGTGCGCACGATGAGCATGCGGTCGAGCAGGTCGAGTGGCACGCCGTGCGGCGACGAGATGTC
CGTGCCGCGGATCGTGCACACGCCGCGGTTCGTCGCAAAGATCACAATCGGCGCCAGTGTCGACTCCAGCGCGCGGTTCAGGTACGTGAAGCACTCGATG
TCAAGCATGTGAACTTCGTCGACAAACAGCACACCAGGAACGAGCTCTGCGACGCCCTGGTCGATGTATCGGTTCACGACCTTGTTGATCTCCGTGCGCA
GCTTCTCCGTGATCTCGGTTTTCTTCGGTTTCATCATCTGGCCCATCATCGACATGATATCTTGTCCGCCCTGCGGTCGCGCGTTTGCGACATCCAAGTC
GTGCAGCGTCACGTCTTGAATCAGTTCTTTCTTCTTGTGCACGTCGCCCTTGGGGATCGGCACGTACTCCTCAGCCTCAAGATCGTACTCGGTCGCGTAC
GCATCCGAGCGGCCCACACGCTTGACTGAGCCGTTATTCGCTTCAATGTAAATCACGTCGCCTACCGACACCTTCTCTTTCTGCAGCGACTCGTAGATGC
TCGGGTCGAGACGCAGCTGCTTGGAGCCCTTGGTCGTCTTCAGACCCACAATGACATGCGAAATGGTCTTGCCATATCCACCGAGTGGGTTCTCAGTCTC
CTCTGGCGTCATCTCCGTCACCTCACCTTCGTATACCTCCTTGCTCTCCTTGATGCGCAGACCGATCGCACGGCGAAAGTGCTCCATGAGGATCTCGGTC
TTCTTCACTTCCGACGAGTACACTTCCGAGCCGACCATCGGGCAAAACGGCACCTTTGGCCCCAGCTCCTGCGCGATACCGAGCGCTAGCGCGGTCTTGC
CCGTGCCTGGCGCACCCGCGAGCAAGAGCGCGCGTCCAGCCATCTTCTTCGACTTGATCAGCTCCACGACGATGCCAGCCGCCTGTTCCGCATCCATAAC
AGGATGTCGTCAGTACTCACATGTACACGCTTATCAACAGCAGTGAGTTCAATAAGAGATACATATACACAAGATATACACACACCTCTCTCGCTCGCTC
CTGACCCACGAGACCTGCGCCGATCGGCAGCGCGACGCCGTCCGAGTCGACGCCGAGCCCTTTCACGTGCGTGTGCGACGCGATGCGCTGCGTCTTGGTG
GTCGACTGCACTTCTTCAATCTGCACACATACACACACAACAATAGGTTAAGCATCATATGCATACACGCATAGATACACAGATACATAGAGAGCGTGCG
CGCGATGCGTCACGGACGGACCTTCATGGCTGCTGCTTCTTCTGCTTCTGCTGGTTCAATTGGTGGCGCTTGCGTTAATAGGCGGCAGGCAATCACACTC
GCGCCAAAGGATACGTTCGTAAAAAAGGTGACTTTTGTCTTTTTTACGAGGCGCCGCTTGGCACGACAAAGCGCGTAATTACGACCAGCTCTTTTTAGAT
AAAATCGAAAGAATTTGTTTCCAGAAATTCTGAGGTTTCTCAATTTTTCTCTATTTTTCTGGACTGAGTTTGGAGGAAATGGAGACTGAGGCATAATTGG
TGAGGGGGGGTACAATGCGTTGGGTGCTGCGAGTTGGT