Description :
From Genome Similarity Track
Location :
Scaffold_553:2537- 13746
Transcript NameFunction/comments
Phyke_g10213hypothetical protein
Phyke_g10214hypothetical protein PHYSODRAFT_554371
Phyke_g10215hypothetical protein PHYSODRAFT_475011
Phyke_g10216conserved hypothetical protein

Sequence
11209 bases(100 bases per row)
GTTGGACCACAAGAATCTGTTGACGATGAGTTCATGGAGACCTGCTTCGTAGATGATCACACAGCCTAGCGGTATGGTGATGTTGTAGAACAGCTCGACC
TTGCGCGCTGTCTGCCAAAAGGCCTTGGGGCGCGGCGGATAGAAGTGATAGACTTGGTTCCCAGCAGGATAGAGGTCTCCGCCAACGACCAGCCAGATCC
AGAGTTGAGAGAAGCTGGTACATGGAATGTAGATCAATATCTGTGTCAGCCATGCTAGTGATACCCGACATCAAAGTAACCTCACCCCACAAGGCAAACG
TACAGTAAGATTGGGATGGTCATCCACAGTCGCACCAATGGCATGTAGCAGAATGCGAGCATGAGCGGAACAACCATGTGCAGTATGAGGTCTACTGAAT
TTGCCAGCAGCCGGAAGGGTCGATACTTGCTCAGGAAGCCGAACCAGCCTTGTAAGATGCCCATGAATGTAGTCCGGTCGATCGCCCGTAGCGAGTACCA
GCCCATCATAATGGTGAGGCCCAGCGATGTGGCCATGCCGAGAGCTGCCTGAGACTCCGTCACGTGAGCCAATACAGTGAAGCCACCCCAGCAGAAGGTA
TAGAGGATCCGCACTCGGAGAAACACAGGCAGCAGCGCCATAGAGAACAACAGAATCACCGCCTGGGCAGAGTCCGCGTTCAGAGTCGTCTGCATTCGAT
CCTCTGTGCCTCGCACCTTCAGAACGGTGCGCGTCAGGGCATTGTGTGCCACCTCGAACAGGTCGACAGAGTCCATCGTAGAATGCACTTGTAGACGGTT
GACTGGCAATGGGCAGCGTCCGTTTCATCAAAGGCGAGACTGATAATGAAACTGCCTCTGCGTCATTCTATGTACTGCGTGTATTACGTGGGACTCGTCA
ATCAGTCCAACTGCGTCTACGAGGACACCTGTACATGCAGATTGTCCTACCATGTATTCAATAAACTAGTGCTTGATAATAAGGAATCAACGAGGAGATC
GCCCCTTGAACGCCGTCGATGAGGAGATCGGGCACTCCACTGCGGTGAGCGAGAACGCACCACAGCGGTACCGTCAAGTTCCCGACCAGCATGGTGGCGC
TTGCTACGGCCCAAAACTGCACTGGGCGCGGAGGTGCAAAGTGATACACGTGATTTGCGACCAGCGAGCCGTCTGCTACCAGGAGCACCCATAGCACCGA
GAACCTTCACGAATGAAACATGCATCTGTTAGTGTTCTTATTGAAGCCGCAGTAAGCTAGCCGCATTGACGCACCCCAAGATCGGCAGCGCCATCCAAAC
CTCGACGTGCTTGAGGTAATTCGCAGCGAGCGCCAGGGGACTCACGAAGTGCAGTAGGAAGTCACCGGTATTCGCGAGCCAGCAAAAAACACGATACTTG
CTCAGGAAGCCAAACCAACCCAACAGCACACTGTCGAACACGAAACGATCGAAAAAGCGCAGCATGTACCACGACAGCATGACCGACAACCCCATAGCAG
TGGCGAGTCCCAGCGCTGTGGGGACTCCATCATGATGGCCATACCAGCAAACGCTGTCCACAAAAAGGTGTACACGAGGCGGATGCGCACGAGCGTCGGC
ACTACTAGCACGGCGAGTAGCGCGGTCAATGCGTACACGACGTCGCTGGGATCACGATTTCCCTCCATTGGCGCTGGTTGAGAAATGAGTAAAGCCAATG
CTCAACTGAATACTGAACACTTAGCCGTTAGGTGCAAGAAGTAGGTGACGTaacgagaagaaaaaaaaacgccACTGTTCTGACTATGGGAATAACTCGT
CACATTGGCGAAGCAGCGACGCAATTACCGTTTTCATGCAGTGTAAGTGATACCGGGGACAGACTTGCGGCTATAGAGAACGACGTTCCGCGACCAGTTG
GTCTTGCCTAATTGAGCCTTGAAGCGGAACCGTCCAGCATCTAGGAGAAATGTGTCAATCTTTTCGACGACATCTGCTCGTACCTTGATCTGGCGGAAGG
ACTGGGGGATCTCTACCCGCATGCGCATTAGTCGCTTCTGTGCAGTCCTGTTCAACAGCATGGATTGACAAGGCGTATCAGATCAACGGAACAGTAAAGT
GAACACAATAAGTAACGTACCGATAGCATTTCCAAGGTTGCGGCTCGATGATTAAGTGTTCGGTCATGTCGCTGACGATCTCCAAGAACTTCCAGAGTCC
GTCGTCACCGTGATTGAGGTGGATCCACATTGTCACGCTGAAGCAGGTGATGAGGTCGAACTTCCTCTGGGCTGTCGAGCGTTTCGCCAACTGTAAGAAC
GGAGCCATCTCCTTGCGAAACGTGGTATTCATGACATCAACATGACGGAATTGCACCTCGTCTCCTGCAGTCAGCCGCACGGGTTTCTTCGCTGCACGCT
TGATCAACACCTCGTCGATATCCACACCAAGAGCCATGAGCGGTCTCCTTGTTGCTAGCTCTTCATTACTCAACGGTAGTTGTGCAGGGttcactgcagc
ttcctccttcGCTTCCTGagtctccttctcctttcCACCATCCAGAGCTTTCAACGCTACCTCAGCTGCCTTGgccttcgccaccttcttcgagactcct
tctccatggcCCAAAGTCTCGCCATCAATCTGCAGCTCGCACACATAACGTCTTCGGTGGCTGCTctctccttcatcttgaatCAGATactccacctgct
tcttctccttttgcATTCGTTCGTTGAGTGTGCTGATGTTGGTCAGGTCGAAGGCCGCTACGCCGTCGCTCTGTGTAGAGTCCACGAGCGTCGCCTGTCC
GTTCAGCGCATCATACAACCCGATAGTCAAGTCTCCTACATAGCAACGTATTAGTCTAGACTCTAATCAGCTTTAAAGCATGGCAATATACCCAAAGAGC
ACAACTACCTTCATTGCAGCCAACGTCGAGCACTGTGGCGACCGCTTCTGAGCCTTCTTTGGTGGTTCCAATGAGTAACGCACGACGCAAAGCATTAGCT
GTCTGTATGTCCATAAATCGCAGGCGTTCATGCACTGGATTGAAGCTGTAGTACGCGTGGAAGTTGCCCAGCACATGGCCCTCAGCGTCCGCCATGCTAC
TGAATGCCATTCAGTGAATGGGTAGAtaggtaggtaggtaggtaggtaTATGTACCAATCAGAGTTTTTACCAATTACTGGGTAACTCTTACTACCTCTT
AAGTACGATTTGTTCGATACCTCTTAACACTTCAGCCGCTCACTTGACATTCTaagctgaagatgctggGACGACAAGTGCTCCGGACGGTGCCGCGTCT
ACCGACGGCCTCACGGCGCCTGGTAGCATCAGCATCGCAAGTTAAAAAGGGGAATACGAATATGAAGGAAAGCAGCTTCTCGCGGTACGCTGGCATGGCG
TTCTTCGGTGCTGTGGTGCGTTGCAATTGTCTACTCAAGATAAAGAAAAGAAGTGCTGACTAACTTACTGTTTTTGGTGCATCGCAGACAGCAACGACCG
CGTATCTCGGCACATGGCAGACACAGCGTTATTTCTGGAAGGTGGATGTCATCAATGAACGCACTAAGGAACTATCAGAGGCAGTAGGGGATCTGCCCAA
GGACGCCACAGCGAGTGACCCCATGTGCGTTGGTGTAGGGGCTGTCCTGGTATACGTTTGCCTATAGTGTTACTTATGTTGTTATATCACTTGATGCAGT
GATGATATTGAGTATCGCCAGCTTCGTGTGAGCGGCAAATTCAAGCCTGGGAGCACGTTCTACCTGTGTACGCAATGAAGTCGTTGGAACGAACCTGTGA
AACGTGTACAAAATAGGAGGTCACTGATACTGTGATACCTGTTGATTTTGCCTATGAGTATTGTTATAGACCCTCGCTCTGCTCCTGCCGAGGCAAGCGA
TTCTGTGGCAATGGTGAAGTCTGGTGGATACATTTATTCCCTGTTGCAACGTGAGGACGGGTAAGAAATTGCCCGTTTGTTTGGACGGTTTTGCACACAT
TCATTATCTGGCTGGATTTGCGACTTATTAAATGTGGTATGGTTTAGGACACCGGTGATAGTGAACCGAGGATGGCTTCCACGCAAACTCTTGGATGTGC
ATATGGcaaagcacaagaaggaggaggacgacgacgtaTCTTTCGTTGGTGTGCTTCGCCACGGTGAAGTGGTATGTGGTTTCGAGATTCAGAAGCTCTC
GTAGGGACCTCACTTTACGTTCTCTCGCTTACTTGGTGTTGCAGAAAAATAACTTTACCCCGGACAACGATGTGAACAACCGCCAATTTTTCTACTTGGA
CCACGAAGAGCTGGCTGAGGCCATGGGGATCGCCTCGGCAAACTTACCCGTCATCGTGGATGCACTCGGTAAGGAGCCTTTGATAAATCTTTCATTAATA
CTTCATGATGTAAACCctgttgtggctgtgtgtTTTGATAGCGGAGGGGAAAAGCGGGCCGGTGACACTAGTCAATCCTGTTCGCAAGAGTATTGCCTCC
TACTTGGAGTTTTACATGACTCCAGAGAAGCATGCTGGCTACGCAGCAACCTGGTAAGTAAACCGCCATGGTTCATGTCTGTGGAGTTGTGGAAATTGGC
GCTGAGACTAAGAATTGAACATTTGTGCAGGTTTGGATGCAGTATTGCGGCTGCTGTGATGGGAATTTTACGGTTTAAGAAAGGAGGAGCTCGAGCTGCC
CGTGCTGCCAGGTTCAATCGCCGCTAAGGTCGATATTGTACAGTGCCAGGTTGTTCATAAAGCAAACAATCAcacgacaacttcaacttccgCTAAAACG
TAGCGGTTTAGACTAATATGTAGTGTGTTACATTAATTTTGAGCTCGTCTCTACCTGCTTTTCGTGCCAGCAGGTatgctggctgctggcttCCCATCGC
TATGATAGATTAAAGCCAAAATGGCGAGGCACAAGGACGTCGATGAGACCACGATGGAGGACGcagtggtgttgctgctcatgctgttcgtgctggTGAC
AGTCTCCTTCGCGCTGGACCGATACTCTTGCATGCTGGTGTCGCAGAGTGGCTTCGCGATGGTGTTCGGCCTGATTGTAGGGCTCTTCATGATCATGGGG
GACAAACACGCGGCACTGCACACGCATTTGAACCTGGACAACAGTCTCTTTTTCAATGTATTGCTGCCTCCAATTATCTACGAAGGAGGCTTCTCCATCA
AGCGCCAAGCTTTCTTCCGGAACTTCCCAGCCATCATGAGCACTGCAGTCATTGGGACCATCGTGTCGGCGGTCATCACAGGTGGAGTGCTGTACTTTGC
CGGCTCAATCAAACTGGTGACGAGGCTGTCGTGGGTCGAAGCTCTGCTGTTTGGCACGCTGATCAATGCAGTGGACCCGGTGGCCACACTTTCGTGTTTT
AACAAGCTGCACGTGCCGCCGTTGCTGTTCAACTTGGTATTCGGAGAAAGCGTGATCAACAATGCTGTGGCTATTGCACTCTACCAAACACTGCACAAAT
GGGATGCTGGTATCGACCTGAGTGCGAAGCAATTGCTTCATGTGGTGATCAATACTGGAGGAATGTTCGTCGGCTCGTTGCTTGTAAGTGCAGCCATCAC
GCTCTGCGGAGCTTTCTTGCTCAAGCGAAAAGTGTTCTCTACGCTACATTACTTTCCGAGTTATGAGATATCACTGTGCTTGATTTTCAGCTTACTCACG
TACTATGTGGCGGACAGTCTCAAGCTCAGTGGAATCGTGGCGTTATTCTTTTCGGGAACAATGACAGCCCATTACCATTTTAACTCGTTGTCGCGTGAGG
CACGTCATGCATTTACGCATCTGCTGCATACAGTGGCGTTCGTTTGTGAGAATGTCGTGTGCGTGTTCATGGGCACGTCGGTGATCATGATTTTCTCTGG
GCATACTGAGAAAAATTCTGGTTCTGCTCTGCGTGTGGATGATATCGATTGGCACTTCATTGGTCTCACGCTCGTAGCGTGCTTTGTAGCGCGATTCTTC
AATATCTTCCCGTTGCTCAGTCTTTCCAACTGGTCCCGGTCGTCTTCTGACCGTATTCCGGTCAAGTATATGAGCGTGATATGGTTTGTTGCTCTTCGCG
GATCCATCGCGTTTGCGCTCGCCAAGAACTGGAACTACGTTGGTTTACATGGAGCGTCGCACCGCCAGCTTGTGGAGTCCACCACtctcgtggtggtgct
cttTACAACCATTGTGGTCGGCGGCCTTACCGGCCCAGTACTATCGGCGCTGCACCTCACAGGTCACCATAGTGCGTTGAGACAATCTGACCCCGAGTCA
AACTCTGATGACTCGTCGACGTCTAGCGAAGATCGTGCACGAGCAGTACAGCGTGGGTCCCGTCACTTCGTGCTCCATCCCGGATCCAGAACCACAGAGC
TGTTTACGATGCCCGTTGGGGAACAGGAGACTGCGCTAGATGATGACCCAGTGCTAACGTCGCGTCCACAGTTCCGAGATAGCGttagtgacgaagagga
aggtATCATCAGACAAGAGACTGACCAAGACTCACCAGCAAATGGTAGTCGTGGAGAGACCCTGACTGGTGCGTTCTTCCGCAACTGGGAGACCTTCGAC
ACCACGTATATGCAGCCTATTTTCGGTGGGCTATCGCAGTCTCGCACCAACCCAAGACCAGTCGACGAAGGCGCTGAAGACCAACAGCTagccaagatgc
agacacAGAGCGACGTCTGATATTTTtttcacacgtcacagaAATGTTATGTTTGTTATGTGTTTTACATCATATACATCATGTCACATATTAATCCCCA
TCATAAGAGAGCCAGCCACACATAGTTAAGCCAAGTCACATCTAATACAGACACCGCCCACCAAGGATGGAGGacgcggtgctgctgctgctcatgctgt
tcgtgctggtgatggctTCGTACTTGCTGGGGCGGTACTCGTGCATGCTCATTTCCCAGAGCAGCTTCGCGCTCATGTTCGGCCTCTTCGTGGGGCTCTT
CATGATCATGGGCGGCAAGCACGCATCGCTCCATACACATTTGAACCTGGACAACAGTCTCTTCTTCAATGTATTGCTACCTCCAATCATCTACGAAGGA
GGTTTCTCCGTCAAGAGCCAAGTCTTCTTCCGGAACTTCCCAGCCATCATGAGCACTGCAGTTATTGGGACTGCCATCGCTACGACCATCACAGGCGGCG
TGCTATACCTTGCTGGCTTGGCTGGTTTGGTAACCAAGCTCTCGTGGGTCGAGGCCTTCCTGTTTGGGACGCTCATCAGTGCTGTGGATACTGTGGCCAC
GTTGAGTTGCTTTGACAAACTCAATGCACCGCCGTTGCTGTTCAACTTGGTGTTTGGAGAGAGTGTGATGAACGATGCTGTGGCGATTGCACTATATCAG
ACACTGAAGAAGTGGGATGCGGATATTGACTTGACGTTCAAGCAGTTGGTACGTGTGGCACTGAATACTGGAGGGATGTTCGTGGGCTCGTTGCTGGTGA
GCGCAGTGATCACTCTGGGTGGAGCTTTCTTGCTGAAACGGCAGTTCTTCGCGACGCTGCGCTATTACCCGAGCTATGAGATCTCACTGTGTTTGATTTT
TAGTCTACTCACGTATTTTGTGGCTGACAGCCTCAAACTCAGTGGTATTGTGGCGCTGTTCTTCTCGGGTACCATGACGGCGCATTACCATTTCAATACG
CTGTCAAAGGAAGCACAGCATGCGTTTACGCACTTGTTACACACATTGGCTTTTGTGTGTGAGAACATTGTGTATGTATTCATGGGCACGTCGGTGATTA
TGATTTTTGCTGGACACGCAGAGGGGAATGCAGGTACTTCTCTTCGGGTGGACGACATTGACTGGTCTTTCATCGGTCTAACACTCGTGGCGTGTCTTGT
GGCACGATTCATGAACATCTTCCCGTTGTTGAGCCTCTGCAACTGCTTGCGTTCTCCACCCAACCGTATCCCTGTCAAGTACATGAGCGTCATTTGGTTC
GCCGGTCTTCGCGGCTCTATGGCTTTCGCTCTAGCCAAGAATTGGTCCTATGTTGGTCTTCACGGGGCGTCCCACCGCCGGTTGATCGAGTCTACGACTC
TTGTGGTGATTCTCATTACGACGATCGTGGTCGGTGGTCTAACTGGTCCGTTCCTATCAAGTTTGCGCCTCACTGGCAAGTACAAGGAACACAACCACCT
CGACCAGACTGACACTGAGTCGAACTCAGGAATTGTATCTGATTCCGACGAAGTTTCACAGTTAGTGCAGCGCAGCACTCGCCACGCTCCGGCTGAAGGT
GAGATTCATGGATCTTTAGCATTCCCCGAGGAAGCCACGGTGAATCGCGACGCTGATGGTAACGAAGTCCCCGTCTTCACTCCACGCCCGCAGTTCCACG
ACGCTATgagtgacgatgacgaggaccCAAACCTTGCCTCTCCGGTACGCCGCGCTGCCGATAGACCTCGCGGTGAGTCTCTCACTGGTGCATTCTTCCG
CAACTGGCAAGCTTTCGACACAACGTACATGCAGCCGGCGTTTGGAGGGTATACACAACGACCCACGATGGTGTCCAACACCATTGACGAAATTGCAGAT
ATAGATCATCGACAACTTGCAAAGATGGAAGCTCAAAGCGCCATGTGATTTTAAGAATTAGCTCCAATACGACCAAAGATTTTCCAAGTGCAGGCAGGCA
TCAACAAGGCGCATGTGCGCATGTAGCCGTTTCCACGAACAGCTCAATAGACAAAAGATATTATTTCATTTGAAGTTAGTAAGGAAGTAGAAAACCTTTG
CTTGACGGACGCCATCAGTTACCTCATTTCCATCGAGTGTGTAGGAATGGCGCCGCCGAACGGCAAGATTGTCGAAACTAATGCTCCTGCAGCGGGTTCC
ATGCTGCAGACATTGTCTAGTGGTGCTGTGCAACCAGGTGTGCCGGCGAATGAGATACCAGCGGCACCCGAGAGCTCAGAAATGAGTCCATCAGAGAGCG
CAAATGAGGAAACTgacgagatggtggaagCGTTGGAGAATCTGATTCTGGAAGCTTACAGCAGTATGCAGAGCGACGGAGAATACATTTTCCTTCCTGA
TGAAGTAGCAGAGAAACTCCACCGCCTTGCTGGCCAGGTGTGTGGCTTTGAGCTTGAGTTGGGACAGATTTTCTAGTGGTTAATGTAGAAATTGCTATCT
GTGTTTTGACGAATAGATGGATGtggaagcagagcaagagGGTGGGGAAATACTACAAAAAGAGGACGAGGTGGCGGCCTCAAGTGCAGGACAAGAcagt
ggcagtggtgacgcTACTattgaggtggaggagacggtggaggtgaaggagcagcaaccAGATCGACCAGAGCCTGAGCAGGAGCAAGAACAGGAGCTTC
TGCAGGAAAAACAGGAGGGGAaaggagaagacgaggaggCGAGGTTACGCAAGGTGCAGGCGCTGCAAATAGAGGCGGCGGAGCTGCgtgaggagaagca
gaagcaacgAATCCCTCGAGTGATGTCGACGGAAAACCTGTTCACAGAACTCGCTCCTGTGCCTGAGATAGATGAAGAGGCATCGAGTGGCACACCTTCA
CCGGCGCTTTCTCGCTCCCATAGTGGTGCAAACACGCCAAATTTGAGGCCTCGCACACCAACGCGAGGACAAGATCACTTCCCGATAATTTCTTTGACCT
CCACTCCGAGTAGTGTCGCTGCAAGTCCTGACCAAATAGGGAGATCTCCGGCATCTAGGACTCCAGATCAATCTGGCGGTAGcaaacaaacagcaagagT
GCCTACTTACGAAAAGAGGAGAGAGGCTGCACGCAAGATGAaagaagacaagaagaagcgcgaaCTGCGTATCCGTGAGGATGCACGCAAGCAACGCGAG
GATGCAAAGCGAAAACTCGAGAAAGCGCACCAGAAGGAtatggaggagaagcgcgaGCGCGTGAAGCGTATCCGAGAAGAGCGGCTACATCGGAAAGCAG
CGGCTAAAGGGACCAAGAAGGCTTAGAATGGATAGCGTGTGTTTGTACAAACTGTTCATAGTGGGAAGCAAGGCACGCTGATACACCAATTTGATATTAA
ATCTCTGTGTCGCTTACATTTTGGGGATTTAAGGGGTTGTCATCATGGAGTTGAGCCAGCGTTTCTGGATCTAACTCTTGGAGAAGCATTCGCATTCCAT
CAATGGATTTGCTCAGGACCTGAGATTCACGCTCCAGGTTGGCTTTACGCTCTTTTAGGAGATGTTGTCGTCGTTTTAATTTGTCTGTTTTCGTCATGTA
CCTGCAACTTCGCCTCTCTAACTTGCTGGTTAATCGTCACATACAGTCAAGGAAAACAGGCACACAAGCGAATGTTACCTTAGGATTCACATATCCTCGA
AATCGCCGGGCAACCCAAATAACATGCATAATAGCAAAAATTACCTGGTATACCATTCTAGCTGATTGACACAATAGCTTGTGTATTGGCACGAAAGCTG
TAGCAGTACGAGAGCCTTAGCGATCCCAACATCGTCTTCGTTCATCTTATTTCCATTGTTGCTGTGGAAATCTCCAACGTCTGCGCGGCCATAGAGCGTC
ATTGGCAGCAAGTCGTGAAGAACGTCTGTGCACCGCTGTGTACATCACATTGTCACGATGGTTACTCATCTTGCTTGATGCTATAACTGCGGTATTGAAA
CCTTACCTCATGAACAACTCCACCGACACGGGCGGCACGAAATTTGCTACTTCTAGCGAGGGACCTATTTGGAATAACAAACTGAAAACCTGatggatct
gctgctgcaggcgatAATGTTGTGTCTGGTTGGTTTGGAAGTGAACTGTTTTCGTATTCGCTTGGCTCTTGAACATCGGCGATCCTGATGCACACGTAAG
TCGCCGTGCTGCGTAGTTCTCCAGCACTCTCAAGACATGCAGGCCTGTTGTTCGGTGTTTTCACGCGGCTGTGTCTTGGAGTATCAACTTCGTACCACCG
CTGCATTGCTCCAGACTGGATCCACTGGTCCAGGTCCACATTCCACCTCTTGATGAACTGAAGTGATCCTGTTGAACGGGATCCGCCCGACCATAACTCG
AAGGAAATGACTCGGTATACTTGATTTTGCAGGTCTATACTAGCTATCTGTTTGCCTTGTTGATTGCCGTGGCGGTGCAGACGAGTTTCCAGCAATAAAC
GGTCTTTGC