Description :
From Genome Similarity Track
Location :
Scaffold_62:25353- 27337
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10482Hypothetical protein
Sappa_CBS223.65SPRG_10483Hypothetical protein

Sequence
1984 bases(100 bases per row)
TTGGTCACATACGACAGAGTTACGGCGGCGGTGTGAGAACCATTGTCTTGAGCGCCGACGTGATCGGACCGAGACCGTCCAGCCCGGGCAGCGTCCGCGG
ATGGTCGCGTGGCTGCTTGTAGTACAGCCATGGTAGGTAGTGAGCGCGCATTGGGCCTTCTCGGCGTGCGCGGCGGCAGCTTGGCGCTCGATCGCCACGC
CCGCGCTCTTTTGCAGGAGCACGTTCACTTCGGTCGCGCACTTGGTCGTCTCGTCGACCATCATCGCGTCGACGAGATCGCCATTCACAGGAGTGGGCGG
GACCGCCTACATATCGATGAGGATCCCTACACTCGACGGGCTTGGGACGTGCCTTGTGCAGGTCCTCGTTGATGCAGACCAGAAGGTAGCCCTGGTACGG
TCCGCTTTCCGGCTGGCGCCTGCGCGTACAGCGAGCACTCGAGCCTCGCGTTGGTTCTGCGACATATTGCATTGGCGTTGGCCTCAATACAACGTCTACT
AGTACTTGAGTACGAGCTGTGGTACAAGAGTCGCGGCGTCATGGGCGGCTCCGTGTCGAGTGGGGCGAGCTTGGTCGTCTTCTCCTCGAGCGATGTCGCT
TCCTGGACGTTACGAGGTCGAGAAGGACACATGCGAGAGTCGATTTTGCTCGGACGCAAACGCAATGGTGCAGACCCCACAAGTTGGAATGTGGATGAGA
TCGGCATCAGATCTGGAAGCTGGAACGTACCAGAAGATCGGAGCGTCGATCGGAGCGTTGCGCTGGAGGTACGCCCATGTCGTCTTGCGCAGGCGCGCGA
CGTACTCAGTTGTGAGGCTGCGTCGCTTGAGGCCGCCAACGCTAAAGTACGAGGCTTCACGCAGGTCATTTTCGGCAAGTCTTGGCGGCTGACGCCCTGC
GTTTGGACATGTCGCTATGGGCGCGGTCCCTTATACTAGCCGTCTCTGTCTCTCAGCAGACACACTGAGATGAACGGAGATCTGCCTTTTCTCCATCGTA
CTCATCACCAAGTGCTAAGACCCAAGTAGGAAACGAGTATAATCTTTGGTCGACGATGCTGCATAACATCACTGGAACTGCGCTGCCATCGCAATCGCTC
GGTCCGAGAGCGCGTGGAGCTGGCCCGTGTTGGTGTCGAGGGCGCGGCAGAGGCCATCGAGACGCATTTCGATGGCGCAGAGCACGGCCTCGAGGCCGTT
GATCGCTGTGTCCAGCGTCTCATGCAGCTGCGCTGCGGATCTCGCGTGCGCCATGACTGTGCCCATCTCGTCGCAAATGCGGTCGAACGTGGACTGGTCC
ATCGTCAAGACGCGGGACTGCGTGGCCTCCACAGCGCGCAAGATCACGCTGGTCATGACGTCGTCCAGCGCTCCGTTCGCTGCAGATAGTCGATCATCCA
AGACGTCGCCCGCAGAGCGAATGCCGGCGATCGCATGGCGTACTGTCGCGAGCATGCTTTGCAGCTCCTGTACCTCGCCCGTGACGCCGCGGACTGTATC
GGAGATGCGCTGCGTCTCGCTGAGAATCAAGGATACCGCGTCGCCCACTGACGTGCTCGGCGGAGGCGCATCCGTGGCCGTGCTAAGGGCAGCACTGGCG
GCCGGCGTCGCGGCTTGCACGGGCGTGTCGACGTCGGCTTCTTCGACGACCTGTGTGTTCGGGCGCTTGGCTGTCGGCTCCTCGTCGTCGCTCGCCGCCA
AAGCGCGCTTGCCTTGGCGTGATGCGCTTGGACTCGCCTGCTCGGAGGCGTTGCTGGACGTCTGCTCGTCGTCCGGCGTCGAGGCTGCGGTCGACTCCAT
ATCAGCTGCGATCTTTGGTGGGCGAGAACCTCTGGTATTGAATATCTGTCATAATCGTTATACTGGTTTGACTGTCAGAATCGATGTTTGTCGGTTGCAC
TTGCTCATAAAAGCGGCGAGCTTCTTCGCCCAGCGCGTGTCGAATCGCACTCTGTCGCATGTCGTACTAAAGCGCATGTGGCAT