Description :
From Genome Similarity Track
Location :
contig_21:25349- 27397
Transcript NameFunction/comments
g4758.t1hypothetical protein

Sequence
2048 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGACGCGCCTTCTTTATCTCGACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTATCTGTCGACACGACCGC
GTCGCCCGGACGCTTCGAGACCCTCTCGAATCGGAATCAGGCCCTGCGATTCGTTTACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGG
GGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGTGGAGGGCCGCATGACTGGTGGAGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGC
CATCGCTCTGTCGCTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACC
ATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAA
CAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTT
CGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAG
ATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACTGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTT
TAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGCGTAGTGACCGATGTTTCC
GCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTAC
CACCGGTCGTGGCATCAGCCGCGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAATCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATT
TGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATG
TTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCG
GGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCCTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCG
TCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGA
GGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCAC
GCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATGATTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACA
GTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACT
GTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTC
TGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTAACTTAAGTTCAGTATACTTGTATCCGCAAGTATAC
TTAAACTAAGACAAAGGGACCGAACGATAGCTTTGGTGCTAAACGAGA