Description :
From Genome Similarity Track
Location :
Scaffold_37:253362- 256941
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13866hypothetical protein

Sequence
3579 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAGCT
CCATGTTCATCAGAACCTTGGGCTCCAACCATATAGCTCAGTGGTCGAGCGCTCGCTTGAAAAGCGTGAGGTCCGTGGTTCGATACCACCCTCGAGTACA
CAGTCCACATACCTTGACTAAGGTTTTGGACTCACTCGATACACGGGCAGCGCCCACCTAGCTCAACGGTCGTGCGTTGGCTTTGCGAAAAGAGAAAAAA
GTCGAGCATTCCGTCCATTGCAAGTTAGTTTACTCCTTCATGAGCATCTTTAGTCTTCAACGCTGTTAAATGAAATATACCGAAGAACCAAAGTTGTGGC
GCGCAATTGAGAATAATTACATACCTCAAGAATGCATTAACCTACCTCAGAAGCCAAATCGTCATCCGAGATACTGATACAGTGAGCATCACGTGGTTTG
AGGTACCTATTGGCATCGAGCATCAGTTCACTTTACAGCACTGCAATACTTAACACACCACCTGCTCATACCACACCATTCCACGATTCAGCAGTTAGTA
TAGAAGTACATTTTAGATGCACAACACTTCAGGCTTACGGAAGTGGAAGGTCACCACTGGCAAGTATTCCTTGAATAATAGGCACATCTCTGTTTCAGTA
AGTAAATCATTTGCTTGGATGGCTTCCTGACAGCAACAAACAACTCGTCAACCAGCTACTCGATCTGCGGTCCCAGAACAAGCCCGTTTTGTCCACCCAA
ATTACAGACAATGCACACGCCACATTAGCCACTCCATCTTCAGTCCCAGGATACACAACCTCAGTTACTCACACAGACTGTAGCCACTGCGAGCTACTCG
ATCTGTAACCGCTTTGCGATCGCACTGCACGCAAAACTTGAGCGGAACGACCTGCTATCACTGTCGGGTTCCTCGGTTCAACCTCCTCCAAAGACGCTCG
AACAGATATTCGATATTCCTATTGGCTGATATAATTGTCGGCGGCTTTGTCAAGACATGGTGACTTTGGGTGACTTTTGGTCATTTCTGATAAGATTTGG
TCCCAGGACATTCCCGACAATACCGGTCAAGCCCCCCCCCCCGGCTTGATCGGTATTGTTGGGCCGCAAGGCCCGCAGGGTTGCGGGTGGCCCACCCGCC
ATTAAGCCCACGTGGCTGGCTAAAATTAAAAAAAATACTTTCAGTTGAAATCCATGGGTAGAACGAGCCCAGCACAGGCTGCTGTGGTGGAAGCTATTGC
GCGGCGCCAGTTTCCACCCTTACTGAGCTACCCTGAAATGATTTCTGGTACACTACTGTCTGAATGGTTTGGATTCCCTACCCTTACATGGGCTCCAGAG
TGCCTGGAGCCCAACCGCACACCCAAATGTGTTGTTATTGGCTGCCGTTGTGTGCCCAAGGTAAAGCAGTACAAACCGCGTATCGTCGAGGACGTGGAAC
ACCGAACGGTACTGTATTACGCGCGCTACCAATGCACTGGCGGGGCGAAGAAGTCTTTTTCTACCATCAGTGACGCATATCTGTCGTCATCTAAGTTGTT
TGTTTTAAACTTCCCATATTTGCTAACTTACAAGACATGCATATCATCGGACATGTTTGATATTCTTTATGATGGTATGCTTTCGACTGAAGGAATAGCA
GGTGCAGTAGCAATGTGGAGCGACGGCGGCAGAAGCGATATTATTGCCTTCTTTCTCGTGTCGGTGTCCAGGTAGAGGTATCGCGAGAAGATGACAGAAC
CTACAGCCCACCTCTTCCCCCAACAGAAGCACAGTACATGACAAGTCATATGTGTTTGGACGCCGAAGTTTTGAAGGACTTGTGGTTAACTCACACTGAA
ATTCTCTCTAGGTTGTGTCTTGCACAGATGAAGGATACTAAATGTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGGTAGGCACTGCAATACATTATTTTCTTCCTGAGCCTTTCATTTGCTCCTGTA
ATGCAGCAACTTGCACATGCATGGCATTTCCTGCGAGATGACCAATTCCCGCCAAATTTAAATTAATTCAGTACGCGTCCTGTCTAGTGCTGCCCATCTC
TCTTTGCGTCTGACCACTGACTGCACGAGGGATATCAACGACTGCAGTTGTGGATTTGCCGGGGAATTCTGTATAAATACTTGTTTACGCGACAATGGCT
ACACTCGAAAGAGAGCAAGCACGCAAAGCAACAACTGAGCTAACCTCTTGTCGCTTGGCGGCCTTCAATATAACCGACATCCGAGTAGCCGCGAGCGCGA
ATACGCTGCAGCGAGTCGTCGGAGAGACGCACAGACAAGGACGAGAATCGCATGTCGGGCATGGAAGCAGCACGGAAATCGATCCGGTCCTGGCGCGTTT
TAAGCGGCACATTTTGTACCACCTTCCCTGGGGTTGTAACGCCGTCTAATGCTTCAGTAAGCGAGTCCAGACCGAGGAACAAGCCCACGGACTTGTCAAT
ATCAGGCCCATCTCGTGAACAATGGTGCGCGTACTCGGTGACGAAACGGACGAGGTCTCGCAGGAAGTGTGTAAGCTCC