Description :
From Genome Similarity Track
Location :
contig_21:25336- 27386
Transcript NameFunction/comments
g4535.t1hypothetical protein

Sequence
2050 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGATACGCCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGCGTGTCGACATTATCTGTCGACACGACCGC
GTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGAATCAGGCCCTGCGATTCGTTTACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTG
GGGTGACCCGAGACAGCCGCATTCCGCGCTGTCTCTGTGGAGGGCCGCATGACTGGTGGAGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGCG
CCATCGCTCTCTGTCGCACTGCTGCTGCTCCCGAAGTACACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCA
ACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGT
TCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAG
TTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCA
GTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTC
CCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTTCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGCGTAGTGACCGATGT
TTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGC
CTACCACCGGTCGTGGCATCAGCCGCGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAG
TATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCAC
GATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTC
TGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCCTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTG
CTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAG
GAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTT
TCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATGATTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTT
GACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGT
TACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATG
GGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTAATTAAGTTCAGTATACTTGTATCCGCAAGTA
TACTTAAACTAAGACAAAGGACCGAACGATAGCTTTGGTGCTAAATGAGA