Description :
From Genome Similarity Track
Location :
scaffold_6:253350- 254891
Sequence
1541 bases(100 bases per row)
AAGTGTATTTTCGGTGCTAACGAAGTACCGATCCTCGGTTGTTATTGGTTAGCTTGATGTTCGTGTAAACCGTGAGAAGGTCGagcaatcgtggagtggc
caaTGCCATAAAATCAAAGGGATTTGAGTTTGGTCTGTCCAATTACCTGCATCGTTTCTTGCGTAACTACGCGGACATGGCACGTCCGCTATTaatcttg
ctgaagaaggacgtACTATGGGAGTGGTCGTCCGcttgtgaagaagcaatCACTCAAATTAAGAATAACTCGATGAAAACGCCATTGCCTGCTTCATCAC
GTGTCTCGAAGCCATATAGCGTGGTGTTGGATGcttctgagtttgcaatcgaTTATGCGTTATTACAAAAAAGAATCAGAAGGACACAATCAAGTCGTGT
CAtttcaatcgcgacagcCGAAGCCAACAGAAAGGAATTAATTTGTACACGGCAAGAAGCTTTTGGCACTGAATTATGCTGTGGTGAGGTATCGTGTTCA
CCTCTTGGGTTCGTCTCCGTTTGTCGTCTACAAGGATCACTCTTGCAATATGTAGCTCAGTCTTCTCACTTGTCACACCGGATAGCTCGCTAGGTGTTAT
TCTTCGCAAATTACAACTTCACGGTCGCGTACAAGCCGGGTAAAGTGAACGTGCAGGATGACGCATTTTTAACGTCGTCTTGATTAGGAGCTAACCATAT
TAGCTATGTCGAACACGATGTATTAGATATGATCATCGAGCGTATAGATAAATAGACTGATTTGATCAACGAGACACCGTAATCGAGTGATATGAGACCC
CAAGACAAACTTCTTGGTCACGGATGCAACGGTATGCATGGAAGGATGGTCCCACTCACGATGAAGTTACACATGATGACGAGCCACGATTTTTGAGTCC
CCAACACGATGATTTAAAGTACAAGATAGTGTACGAGGCGCATGATCGGCCACTTAtccgtgagaagacctaccagTATCCCAGAGCTTAATTTTGGTGA
CCCACATGTACAACTGAGTGGCACGATACGTGAGgacatgcgatgtctgtCATCGCAAGACAAACGGAAGTGCCACTGTAAAGTCTCTCTGCTCCTATTG
ACCGCTGAAAGTCAGTCAATTTCGACTTTGTCTTCAGTATCCCCGAGAATGTTGACGGTGACAATGGAGTGCTCGTCTTTGTCGTCagattcagcaagat
ggtgcgCATCACTCCATGAAGTGATTCATTCGATGCCGAAGGTTCGGTTagattgttcattgatcacgTTTTTTGCAATTACGGGTTgccagacgccatc
gtctCATATCATGATACACGATTCACGAGTTGCTTCTGAGACGATTTTTTGTTTTCCTGGCATTCGCTTTGATATTTCTACGGCGGTGCACACGGAGACC
GATGGGCAAACACATTGTGCCAACCGAGTGTTCGATGATATGTTGAGAAGCTTCAGCGCGAAAAATCCCGCGGAATAAGCTCGTCGTTAACATTGGTTGA
TTCTGCTATGAACTATTCAGCTCATTCATCTACTTGGCTTT