Description :
From Genome Similarity Track
Location :
Scaffold_109:25327- 26943
Sequence
1616 bases(100 bases per row)
TACCTGTGCGAACAGACTGCGCGCCGCTCGTTGGACCTGAGAAGTGGATCGTCGAATCAAAAGCAGACATTGCTGTGGCTCGAGGGCGCTAAAGAAAGTA
GCGAGACTGCAGGGCGATTGGCGCATGGCATGGACCGCGCGCTGGGCGAGCTGGTGCGCGTGGCAACACAGGGCCTCGTGGCATCGGTGCTCGTGCTCTG
GTACGCGGGCGGGTTCGTCCAGATTTACTTCAAGGTCTCTATAGCCTTGGTTACGACTGCCATCTTCTACGGTCTCTACTACGCGCTGTGCGCGTGGATA
GGCATCAAGGATCCGGCTGCGTCGGCACCGTCCCGGGAACTGGATTTTAACGACGTCAAGCTGAATTCGTGCGCCAAACGATTGCCCACATGCGCACGGT
CGCAGCGCTCAATGCCCAGGACAAGTGCGTGGTCAACGCCAGCGCCGTCAGGAAAGAAGACGAGGCCAACGGGATCGGTCTCGCCAACTGCTGGTCTCTT
CGCGTCGCCAGGGTTCTTCTGGCAGCGTGGTTTCTAGTCGGGGTTACCGTCCTGCTGGCGTGGGACTCACGATCGCCACCGCAGCTTCTTGAAGGCTTTA
ACGCAGTGGGACCGTGATTTGTCATTCTGACCTCGGTACTGCAGGTTATGGTCCACTACACCACCTACAGAGCTGCCTGGGACTTGGTCCAGTCGTGCCG
CCAAGCAAGCCAACGTCCACGGCATAATCATGGCGCTGCCGCTGCAGTACGATTCGCCCGCGTGATTGCGCGCGACCCGAAGATCCTGATTCTGAACCAC
GCGGCCGACGGACTGCAGAGCGAGTCGAGCCTCGTGAGAGAAACACAAGACGCGCTGGTCGACACAACCACGGCGACGACGCTTGTGCTCAAGATGATGG
ACGACGACGGCGTCATGGGCGCAGAGGATGGCAGTGTTGCAGCCAGGTCACCACGAGCACCACGCAAGAAGAATGAGTCTGGTGGGGCAGTGGCAGAGAT
GAAGATCGCCTCGACTCGTTGGCTTGCCGACCACGCCGACCCAGTAGACAAGCCGTTGCTCTCGCTCGCGGGCCTCGTTAGAGTGACGGCGCCGCTCCAC
AAGCTGTTGTGGGGAGTGGTACTGGCCGCACTCGCCAGTGGCTGCGCGGTCGTGTGGTTTCTCGTCGCGGTCTCCGATCTCGTGTCGGCGAGAGTTCAGC
TATACGGCACGTGGCACGCGTCGCAGAGTGAGGCTGACCTTGCCAAGCTGGAAAGTATCACATTCGGAGTAGTGCTCTTGGTCGGGAGCCTAGTCGTGGC
GCTGCTCAGCTTCTGCACGCACGCGCGTTTGTGTCGGCGACAGTCAAGATGAAGACGCTCACGTGCGAGCTCTGCCTGCGTGGGCTTTGTCGCCGAGACA
TACTATACTTTGACTCGCTCGCCTCGTCAACTACAGTTGCAAGCGAGCTCTACACCACGGCTAGTCGTGTGGCCCAGTTGTTGGGGTCCATGGCGGCAGC
AGTCTTCCTTTCAGTCTCATCACTGCTCATCGCGGCAGTCGGTGCAATTGTATCGAGTGGGAGTTTAGCCCTGGCGACCGGAATTCTCCTTGTGCTCGGT
GGGCTTGTTGGCATCG