Description :
From Genome Similarity Track
Location :
Scaffold_2:253214- 254788
Transcript NameFunction/comments
Physo_110467predicted protein

Sequence
1574 bases(100 bases per row)
AAGCACTTACGAAGCATATACGAAGAGGCTGTTGCGGATGGAGACGGCCACCTCGTTCAGTGACGGGTGCCAGCTGGTCTGCAAGATCTTCTTCGAGAAA
TCCAACGCGTCTGGGTCGCCGGGAGCGGGCATTGCGGCGATCTGATGCGCGAGGCCTCGCTGCGGCATTGAGTGGCGACGACTCACACGCGCGGTGCGCG
GGGTGATCGAAATGTCGGCGCGCCCATAGCGGTCATAAATATGGAACTCGCTGTTGTACGAGCCCGTGATGAAGTTGTTGCCGTCCCCGCCAACCGCGCA
CTCGAACTTGTCGAAGATACAGTCGCTCTCGTACAGATCTCCCAACCGTGGACGAAGGTGTTCGTGAATCTAACCACAAAAGATAATACGTGACTCACTC
AAGAAAACGCAAAATGCAAATACCCCGACAACTTACGTTGATTGTTTGGACAGGACGCGAGTTCATGTTAATGTCCCAGACTTTCAATGTTAGGAAGTCG
CGCGCAATAATGTAGCGACCGTCCGGAGAAAACTTGATGTCCGAGATGGAGGCAATGATTTCAGAGAAGAAGCTTCGTGCCTCGGGGTCCTCCTGCTCTT
CAAACACTGCTTTCCATCGAGTTAGTGCGAACTGAGCAAGGCCACAGCAATACACAAAACGTGCTCTGGGCGATGCGTACCTTGGGAGTACGAGTCGCAC
AGCGCTGCCTGGCGCATGTCCCCAAGCTTGATGGACCCGCGACTTGTGCTGTACATCATCGTGTTGCAGTGTGTTGGGTGGAAGTCCGCAGCCGTGATAA
CCTCCGTGAGCTCCTCCATGTTCGCTGGCTTGATGTCCACAATGTCTATCCACATTTGTACAGTATGGAAATGATTGGGTTAGCTTGCATCTTGCACATT
CGGTAGGAAACAGCCTCAACAACGTACTGAAGCTTTGGTCCGAGTTTCCTAAACTCCAGAGGTTCACGCGCAGGTCGTCCGCCGACATGAATGTCTCTCC
GTCGCTGTTGATCGCGATCGAGTTGATGTGGTACGTGTGCGCGTTCGCGTAGACGCGCTTTGCGGTGGATGTTGTCACGTGGCCGCGGACATGCGTTTGC
GGCAGACGAATGAGTGCCGGCGTAATATTCGCCCGCGGGACGTGGGCGAGGCCTTGCTCGTTGAACGTCGTGACCTCACGCACACTGCGCTCGTGGATCT
TCCACAGTTTGATGGTCTTATCATTCGTAGACAGTAAGCACTGGGACCCGTTGGACGGTCGGCACCACTTGATCTGGTTGATTTTCTCCTCGATCTCGAG
GCTCTTGAGGTAGTCGAACTCGGCGTTGTGGCTCTGGAACTCGGTGTAGAGCTGGTACTGCGGGTCATTGGAGCCGCTGCTAAACATGCTCTGGTTCTAA
TTTACGAGAAGACGGTTAGAAGACAGTCTGCGATCCAATACATCAACCAACAGCCGCGACTGACCGATGCTGGATTCCCGTGGCGGCAGTAGATGGAGAC
GCGGCCGCCTTTGTTGCCTGTGGCGAGGAAGTCTCCCGAGCGGTCGTACTCGATGGCGGAGATCACCTCGGCTG