Description :
From Genome Similarity Track
Location :
Scaffold_51:2532- 7042
Transcript NameFunction/comments
Physo_413512AlNc14C148G7453
Physo_408323AlNc14C142G7279

Sequence
4510 bases(100 bases per row)
CAAGAATCGCTCGTCAAGTGGCTGCGTGAGCGCCGCCGCTATCGTGAGGCGATTGAAGAGCGCTGCCGCATCAGCCAAGAGCCAGTGGCCTCGGTGCTGC
GGAGTGTGCGCGCTTCTGTGAAGCCGAAGCTGCTCGACTACCTGGCCCGCTACGTGTTCCGACAAGACCGCGACACGATTGGTTGACCAAGCGATCATGG
ACAAGATAAAGGAGCGAGTCGCCGAGGTGATGAACGGGCACATCCCGGACATCTTCGACTTCTTCAAGACCCACCTGAGAATGGACTTGAAGGAGCAGGA
CGTGGAGGCAAGGGTCGTCAAATACTTCGTCGACTTTGACCAGCTCCTCGAGGAGCACGGGTTTGCGTCCATGCTCGCGGCCGGTGGTACGGACCGACCT
GACTACCGCGACCGCATGAAGAATCGCTGCAAGTTGATTATCGAAAACCTGTCGCCGGCCATGCTAAAAACCGAGAGCAAGCGGTTGGTCTCGCTCCAGC
ATCGTGAGGCCAAGACGGACGACATTGCGTTGCATCAGTTGATTCTCACCCGCGCCAAGATGCAGCAGCGGTATCACCTGATGGAGCGCGAAGAGAAGGC
TGACCGCAAGCATCCTGTGGAACCGGACGGAGGCCGAGCGACACCGAAGCCGGACAACAGGAAGGCGGAGCCGAAGCCGGAAACCTCGAGGTCGCCGAGC
AGCAGGCCCGGTGTGAACAACTCGGCCAAGACCCACCAAACGCCGCCAAAAGACGGGTGCCTCTACTGCAAGGGCCCCCACCTTGATCGCTTTTGTCCAA
CTGCTACGGAGGAGCAGAAGCAGCAGTGCTACCAGCGTCTGCGTGAGTCGAAGGTGGCCAAGATCAAGGCTGCTCGTGTTCGGCGTATCCCTGGTCACCA
CCAAGTGGTGGTCAACGACTTGGTGGAGCTGCCGTATCGGGCGGACACAGGCTCCGAGGTCAATGTGCTGCCAGCCAGTGCTGTTCGGGACCTCGCGGCA
TGTGGATCGCCGGTGGTCACCTCTGCGATGGAGATACCAGTGTTCCTGGAGCGAGTTGGAGGGGATCTCCTTGCCTGCAACACGTGCTGTGACGTGGACG
TCATGCTGGGTACGGCAGCTGGACCTGTTCATCTTCGCAGGGTTCACTGTGTAATTCTCGATGATGATGAAGAAGAGTTCTTGCTGGGAAACCCAGGGCT
GATCTCGCTTGGCATCGACGTTGATCGCCAAATGGAGCAGTTGGCAAGTGGAGGTGGTCTCGATGGTGATGACGGAGATGATATCCGTGGTGATCCTGAG
ATCGGCCGTGACTCCGACGCCGAGATGACTGAGTTTGTCAACGGTCTGCTCAATACGGCGGGTGCAAATGGCTTTCCGGAAGAAGATATGCCGGCTCTGA
GGCGCATAGTGCTGGACTACAAAGATGTGTGGCGTTCGCGTCTGGGAGCAGATGAACCTGCGAGAGTGAAGCCATACCGCGTTACGCTGGAGGAAGGGAC
GCAGCCTATCCGCTGCAAGCCTGGGCGTTATTCGCCTCTCGCCAGTTCGTACACCAGCAACTACATGAGGGAGTTGGTTGCCAGCGGGTATGTGTACCCA
AATAATGGCAGTCGCTGGTCAAGTGCAGTCGTCCCTGTGCAGAAGGCTGGTGGTGAGGAATTCCGTGTCACTTCGGATTATCGTCGCCTGAACAGCATTA
CAGTGCCGATTGTTGCCAGCGTGCCGAACCTGTCCGTCGTCTCGAGTCGTGTCAAAGGGGCGAAGGTCATCGGCAAGTTTGACATGTTCAAGGGGTTCTG
TCAGCTACCGCTGCATGAAGACAGTCGTGAATATTTCAGCATTCAGACGGATGAGGGTGTGTTCACGCCAACTCGCGTTCCGCAGGGAGGAGTGGACTCG
GTGCTGCACTTTCAGTCCACCATGCAAGAGGCCTTCGCTGATCTAATCAATGACCATTTGCTCGTGTACGTGGATGATGTTATTCTGTTTGCGTCGACCT
TTGAAGAGTATCTGGAGGTCCTCGAGAAGTTTTTCGCGCGCCTGCGAGAGCTGAATCTGAAGCTGAACGTGACGAAGAGCTGTCTTTATCAGCAAGAGGT
GACCTGGTGCGGCAAGATTATTGATGGGGATGGAGTGACGCATGACCCGGCTCGCGTTGAGTCGTTGGTGTCATTGCCGCTGCCTCTCAACGCTGCTGAG
CTTCAGCGTTTCCTATGTGCTGCAAATTGGCTAAGAGACTCGGTCGTTGACTATGGACGGGCTGTGGCTCCGTTGCAAGCTAAGTTCGATGCAGCGATGC
AGGGACTGAGTCGCCGTAAGCGCCAAGCGGCTGGCGTGGAGATTTCGTGGAGTGAAGATGAGATTGAGCAGTACAAAGCGTTTTTGAAGCGGCTTGCGAG
CTCAGCAACACTTTCGTTTCCTGATGACGATGCCGTGGTGTGCCTCAGCTCGGATGCACTTTCGTTTCCTGATGACGATGCCGTGGTGTGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGCCGCT
TCAAAAACGCTCCCAAGTGAAGGACTGGAAGGATGGCGTCCCGATACACGAGCAGAGTCACGAACTGCTTGTTTGTAAAGGTGGTTCTTTCAAGGGATCA
CAGTTGCATTGGTCTGTAGTGGAGAAAGAAGCCTACCCAGTTGTCTACGCAGCAACGGAGCTTGAGTACTTACTTCATCGGCCACTCGGATACCGTATTT
TTACGGACCACGCCAATCTGATCCAGATATTTTGCCCGAGCAGCGATCTCAAGAAGCACGTTCGGGGTAAATTGCAGCGCTGGTCATTGAAGCTCGCTGG
GACTCGCTATGAGATTGACCACGTGCGTGGCGAGGATAACCACTGGGCTGATTTGGTGTCGAGGTGGCCAGTGCGCGAGGACGTAGAGGTTGTGGTGAAG
GCCAAGACTGTGAGGACTCGGAGCCAAGCATCACCTAGTCAGTTGCGTCCTCTGCAAGACGATGATTTTGAGAGGCCATCTCCAGAAGCTGTCCGTGAAG
CTCAACTAAGTTACTACCGTGCACTACCAGCTACGTCGGAAGAACGAGAAGGTCTTCAGTATGTCGACGGCAAGGTGTGGATTCCCCGCCAGGCGAAGGA
TTTGCTGACTCGTGTGCTGGTTGTGGCTCATTGCGGTATTCAAGCTCACCGAGGTGTCCAGGTGATGTTGAATCAGCTTCAGGGCTCGTATGCCATTGAC
AACGTCTGACACGATTTGTCAACGGATGTCTTCTCTGCAAACACATCAAGGGAGGGAAGCTGGTGCAGCGTCCCTGGCCAGAGACAGCGACGGCTACCAA
GCGGAATGAGGTGCTACACATGGATTATATCTCAATGGGAGACAGCTATGGAAGTACGAAGTATGTACTCGTCTCAAAGACGAGCTAACTCACTTCTGTG
AGCTGATTGCCTGTGATTCTCCAACCAGTGATGTCGCTGTCACCGCCATTTTGGACTGGCACAAGCGGTATGGCCTCCCAGCGAAGTGGGTCTCCGATAA
TGGAAGCCATTTCGAGAGTCTAGTGATGGCTGAGCTGGCCACGCGGCTTCGTGGGATGCAAAGTTTCGTGCCTGTGTATTCACCCTGGATCAACGGCACC
GTTGAACGGATCAATCGAGACTTGTTGCAAGTCGTCCGTGCGTTACTGCTGGAATTGGAGCTGGACACACACAGTTGGGAGTTCCTGTTGCCAATTGTAC
AGGCAAATCTGAACCAGAGCGCTGTTGCTTCACTTGGAAATAAGGCGCCAATGGAGCTGTTCACGGGTCTTCCAGTCACGACACCGTTTGCTTCCTGATA
GCGATTCGCCGTTGCAGCACGTCGACCTGAGCAACGTGGAGGCGTTCCTGCACCAACTCCGTGCAAGTCTACACTTGATGCACATGGACGCGGTTGATCG
CAAGGAGAGGCGCCGACTGTATCAACAAGCTCAAAAGATAGGGGACATCTGCAATTTTTCTGCTGGCGATTTCGTCCTCTGGTCTCGTGTGGACGCGCGG
CGGGATAGCGGCAAGCTCCTAGTCCGGTGGGTCGGACCTTTTCAAGTGGAGGAGGTCAAGTTGCACTCGTTCCTGATACGCCACTTGCTGACGCGAGCGG
TTCATGAAGTCCATGGATCTCGTTTGAAATTCTACCACGACCCCAGCCTGGAGCTCTCGGAGGAGCTAGTGGAACATATTGCCAAGCAGGGCATTGTGCT
CGGCGTTGAAGCCATCCTCCAACACCGGTACAACGAGACGTCCCGTCAACACGAGCTGCTGATTTCATGGGTTGGGCTCGAGTCCATTGAAGACTCATGG
GAACCGCTCGACGTTATGTTAGCAGACATCCCGACTAAGGTGAAGGAGTATGCTGCGAGCCAAGACGACGCGGAGCTACGGGGTCTGTGCGGTCTCCAAG
CTGTGTCACA