Description :
From Genome Similarity Track
Location :
Scaffold_1119:2532- 3736
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1119-snap-gene-0.4Cysteine protease family C01A

Sequence
1204 bases(100 bases per row)
GTACGAGATATCCGAGAGCACACTGCACGCACCGTCGCCTGAAATGCCGCGGCGCAAGCGAATGTAGCCGCTCTCTCCCCAGCGCGTGCCCCACGAGTTG
CGGATCTTGATCGTGCTCTCATCGTACCCGACCGCGAGCACAATGTGGTCGATCTTGCTCGTCTCACACGAGGACAAAACGCCGCCCTCGTACTGCTTCC
ACGCGCTGTTGCCTGCAGCCACCGCGACCACGACAGGGTGTTGCTTCAAGATACGCACAAGTCCGTTCTCCCCCGAGACACTAACGGTACCCGTGACCAC
AGGGTAGCTTCGCTCGCAGTTGTTGATGTTGCATTCCGAGTTGCGGTTGTTGCTCGACGTGTATGGGTACGCTCGCTGTGTGCACAGACCATTCTGTTGG
ATGTACTGGAACGNNNNNNNNNNTGTCACACGCAGAGAGAACACCGCCTTGGTATTGCTTCCACGCGTTGTTGCCGGCAGCGACCGCGACCACGACAGGG
TGCTGCGCCAAGGCACTCAAGAGACCGTCTTCGCCCGTGACTCGGGTGGACCCCTTCACACCAGGATCAGTCTTTTGGCAGTTGGCACTGCACTGCGCAC
TGCCGCCGTTGCTCAAAGTGTATGGGTATGCTTGCTCCGTGCACAGACCGTTCTGTTGGATGTACTGGAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCAGCCGTCATTCCTGGTGTTACAACTCGTGAGTTGCTGCTCCGAGTACTTTGGCTGCGACTTTTGGCCACCAGCGATACACTG
AGCGGATTCCACAGCTGCGATACTGGCAAACGCCCAGCACGAACCGCACTGACCTTGGTTCTGAATTGGAGACATGCATGGACTTGTCGTCCAGTCAATG
TAGCCGGAGGATCCTTGCGTGGACGCCTCGGCAGCGACTGGAGCCTCCGTGGCAGTGTCAAAGTCATAACCAGTGGTATCGTCCGAGGAAGCAGGGGCAT
CAGTCTGCGGAGCCATCGTCAGAGGAGAAGGAGTGGCCGCTGGAGCCTCTGTCTCATCTGGATACTCTGGTGCAACGGGCAAGTTGTTGTCTCCGTCGGA
TGGAGCAGACGTCTCAGGTGCTGCCGTCTCTGGTGCTGCAGTCTCTGGGGCCGAAGTCTCTGGGGCCGAAGTCTCTGGGGCCGAAGTCGCAGGAGCCGAA
GTCG