Description :
From Genome Similarity Track
Location :
Scaffold_10:253199- 254905
Sequence
1706 bases(100 bases per row)
GATAGGTTGTATATTTACTCCATATGGAGATCGTCGCCCTGCCAGGTAATTTTTTACCTCGTCCAGCAAACAAAGCGTACCGTGAGCTAGATCCAACCGT
ATCCCTGCTGGCACCATAAAAATTATGGCTAATATTGATGCTTGGCAAGCTTGATCGCCCACCCAAACATTAAAATAATATACCAGCGATCCGTTTAGTG
TGATCATGATCTTGGTGCGCCCTCCAGTCATGTAGGCGTTTTCCCCGATTCCCACACATTCTTGCTTCTGGCTATCATCGATCATACATCCCACCTTACG
AGCAAAGGTAGCGTCGATGATTGAGACTTCGGCTCCAGAATCGAATAACATAGTGGCCCTTTCGTTGTTGATTTTGTCCACCGCTTTAGCTTGTTTAAAC
CACTTTCCTGGTGTGTACTATTTCCAATGTCCTCGCGACTCTCCGGCGCTAGATTGAGATCCATCTTAACGGGAAGTCGCGAATGTTCATCCACCCTTTT
CACACTTGAAATGTTACGCAAACGATGGTGTCCCAAATCACATGTATTAGAGATCAGGCCGATCCGATTGTTACTCCCTTGATAGATCCTTTCCGTCTCC
ACAAATGCATATATGCATAGCATAGAACGCTCGGCTCGTGCCAGATTCCAACCTGTCGAGCGTCCTAGTTTAACATCTCCTCCGCCTTGCTCGGTAGTAG
CCCCGCGTGCTTGGTTGGCACGTACCACTTGCGGATCAGGTTGCAGAAATCTTCCATGAGGAATTGGCCGCTCACATGAACCTCCCCACAGGCGGGACAA
ACATGCAGACATCTGTCCGAGTTATGTACTTTGCGGCCACACTTTTGACAGGTCAATCGTTTCCAACATCCGCGATCGTCATGTATTTTCGAGCCACAGT
GTGTGCAGGCTTTCGGAAGTCCGACGCGATCGCGATCATCGTCCCGATCTGTCTTTCGCGATCTGTCTCGCTCTCCCGGATCTGCGACCTGATCGGAGGC
GGTCGTCACACAGACTTTGCGGCGAGACTCTTCTTCATCCGATCCGTCCGAGCTTGAGTCCGAGTCACTTTCTTCACTTCCACGCGAATGTCTTTCACTT
CTCGCGGCATTTTTAAATATACCGTAGACGACGCTGTAGCCGATCGCGATCAGAATTTGTTCGATTCGGCCGGCTCTTTATTCTGTCAAAAGCTCATACG
CTGATACACGTGTAGAGTTTCTTCCATCGTGTTAGCGTCATGTACTCGCAATAGAGTCAGTTGCTTTACCAGCTCTCGATCGTCCAAAGTATCAATGAAA
TGCTTCACATGCTCACGCCGGCATGCTAGCGATCCATCTCTGAACGCCACTTTAGTTCGCATTTCTGCCACATTCAGCCGGTGGAAATGTTGCAACGGGG
TCTCATTCGGTCGCTTCCGCACCTGGTAGTACTGCCTTCCTGCTGACATTCCGTATCCTTCGTATTGGACCATAAAGCTTTCTGACAATGGTTTCCACTC
ATTACGGGTTGACCGGCTCAACTGGTTGTACCACTTCCGCGCCGGTCCTGTCAGCAGGTCTCCGAATACTAAACATTTTTCTTCATCGGGAGCTCGATAG
CATTCGAATGCAGTCTACATCTTGTTGAACCAAATTCTGGCACGTTCTTCGTCTTGATCCCTCCCTAAAAATTCTTTCAGGTCAGTCGTCACCGACAATC
TTATCC