Description :
From Genome Similarity Track
Location :
Scaffold_17:253181- 255217
Transcript NameFunction/comments
Phyin_T30-4PITG_09831Putative uncharacterized protein

Sequence
2036 bases(100 bases per row)
TCTTTACGATGTTCAACACTTTCTGGTACATGAAGCTATACATCAGAATGTCATTAGGGCCTCCGTTGATCTCATTACTTTTAGATCGGACTCACGGACT
AACGTTGATTTCCTTACTTCCACATCGGACTCACGGACTCACTTGCGAAAAAATGCCAAGTCATGTGTATAATCTGGCAACAGGCAGACTTCATCGTATT
CCTTCGACATTCGCACGACATTTGACGATTGCGCAACCACGTCCACACACTTGGATGGCCTCAATAATGTCTACAAGCGATGAAATTATGGAAATAAATT
CGGTATTTTATTCTCTTTGTGTGGCTTTGTGCCTTTGTCGTAGGTACACAACCGAATATGGTGACATTCATACGCACTTAAGTACGAAATCACATAACCA
TTGTGTGACTCTAACATCGATCAAATAATTTTCATTACTGCACCCGAAATCAATATTTTGAGCTTTGTACCTGTACTGTAATTAAAATTGACGTTTAAAT
GACTGTGAGTAGAGCTGCACATTTAACCCTCGACATGCTTTTTAAAATAAATGCACATTAGATTAAATGCGATAAATATCACGCTAAGATAATGCGGGGT
ATCTATGAGCCTGGCTAGTGTTGCATCGAGTCGCTATTAAAAAGCTCCAACCCCGCATATCTACTATTAATACATGTACGTAGAAATACAATGTACAAGA
CTGTAGCAAACGTATTTAAGAGATGCGATACGGTGGTTTTCGAAATATCATTTTCTAAGAACGCGAGCACATTTATATTTTGAGCACATTTAACTGCCTG
TTGTCTGTCGAACTTATAATAAACGTTCAGTAATGACTCCCAAGAGTACATGACCTTGATTGCGGATCTATGAATCATAGTATGATCCCTTTTACAGAAC
TCTACCTGGTTGTGCAGGAACATGAGCTTCATGTACCGGTAGCCGTACCGGTGGAGTCCATCATTTACACTGTCGTCAAATTGCACGTTAGATCGAATGA
GCCCAGGTTTACAATTCATGTACGGTAAGCGCTCGAGTGCGAAGCGTGTCAAGCCTGTACAGGCAAAACACTTGGATACCGTCTTGTATTAGACATGTAC
GCCCCTTTTTAAAGGGATAGCTTCGTGCCACACTTGCTGAAGCTATTTTAACAGAAACATATAAATTATTAAAACTGGTTTCAATGAAATTGTCCAGGTC
GGACCTGCAAGCAAAAAAAAGATCGCTCGAAGTAGCATTTGAAATGCTGCATTTCGCCTACAGCCGATTTTCACACTTGGTCTATGTGCAATGAGACAAT
TTTTAGGAAACAATTGTCAGATCTTGCACCTTAGCTTCAGCTTGTCGCAACATTAAGCTTTTTTAAAGCAACCTAAACGGTTTAACCGCAACTCAAGACT
TTCGCTTCAGTTCCTCACCAGCCAGGGATGCAGATTGGCAAGGCTCTTGCCTCCTGTTCACCAGCCTATGATCTATCCTATGCTTTGATCGGTGCCGAAT
CTCCCGTGGTTCCCCTGTTTTGTATCGACCATTATCCAATTGGACGCGTGCTGGGAACCAGCTTAGTTTGTGTGTGCATTTCGCTCAACCACACTTCTAG
AACAGCTCTACAGGAACCCTCAACAGTAGAATATGCAGCTCGTCAAGACACTTTTCGTCGCCGCCGCGCTCTGCGTGGCTATGGTTAACGCCGGCAACGC
TCATCAGCAGGAGCAGGAGCAGGAGCAGGAGGAGCAGAACGGCCACCAGTACGGCGTCGACAGCGACTCGGACTCGAAATCTGGTTCCAGTACGCCCTCG
CCCGTTCAGAAGGGCTTCGACGTACACCAGGTTAAATTCACGACTGGTGACCCCGAGGAAGAGAAGGGCGAGGAGTCCTCGACCGACTACACGCTACTCT
ACGTGTCTCTCGGCGCCTGCGCCTGCATCGGTGTGTTGGGCGCTGTGTACATGAAGCGAAGGAAGGAGGACGACAAACTGCCCGGCGAGATCTTCACTAT
CGACGATAAGAACTCGGTGCTGTAAGCGTGTTGGGG