Description :
From Genome Similarity Track
Location :
Scaffold_7:253170- 257340
Transcript NameFunction/comments
Physo_129249hypothetical protein
Physo_108364PREDICTED: similar to ribosomal protein L35

Sequence
4170 bases(100 bases per row)
GACGCCATCGACCCGTAGCCGCCACCTCCCGATATGCTCTTCTTGGCAGAAATCTTGATCCGTGTTGCTGGTGGGTCTTTGATCAGACCCGTGTACTCGT
TGATCTCTGGCAGCATGTGCTCCTGCACCGTCGCGATGTTGGACGGGGACAGTCGACCTTGGTGGAAGGAGAAGGACTTGGTGATCTCCGGCTTGGACTC
GAGCAGCGAAGTCGGCATCTGGCACCACAACCCGCCGGTGAAGCAGAGACTCGAGCCGCCGGTGACGAAGTAGTACTGACTGCGGACCAGCACCGTGAGC
TCCTCTTCAATCTGCAGCAGTCTCTCTTCCAGGTCAATATCGTTGGCGTCCAGACCAAAGGGACATTCAATTTCCATGGCGATCTCGTCGGCCATGAAGA
GAAAAGTGCCCCACACGAACACCCACGCCGGCGTGTAGAGCCCCGAGCTCGGCACGATCACGACCATGTAGAGCAGCATGTAGGCAGCCAGCAGGAACTG
CAGATACTGCATGTAGTTGAACGGGATCGGCACGTTCGCGATGTGGAAGACCGTCGTGTACAGGTTCGGCAGCTGCGAGATCTTACTCTGCAACGTGCTA
GCGTTCCCCGGCGTCAGATGACCGCACTGTGAAGCAACCTGCACCAGTCTCTTGAGCCAGAGCTCGGTGATGGCTGCACGCAGCTTGTGCGGAGTCCGAC
GTGTCAGGTCGCAGTAGGACTCCACCTCGTTCATCTCCTTCTTGTACTCCGAACCGGACGCGTACAGCTCGTCGTACTCGGCCTCAGTCAGCACCCCCGT
GTCCCTCAACTTGTCAATGCCGTCGCGGCCACGACAGTCGTGGAACACGATGGCGATGTACAGGAACACGAGTCGCCGCAGCTCCGTGAAGAAGGTGCAC
TTCTCGAGGATATCGCGCGAAATGGGTCGCGGTCTGTCGTGGCACTCGCTGCCATTGTGCGCGTGCTTCTTGTGCTCTTGCTCCGCTTCTTTGGCGTTGG
CTTCGTCCTTGCTCTCCTCCACCTCCTCCTTGATGGTCGTGCTCACGTACGCGCAGCCGGAGCCGACGATGTCCCTCGCGGCCTCGGAGAGCGCCCCCAT
GGCCACCATGCCCGCTCTCCACTGGTTGAAGGCCGAGTTGAGGCGGAACGAGATGATGAGCCCCAGGAACGTGTTGAACACGGTGAGCGAGTCCGTGAAC
GCCATCGACTTGTTGGTGGCCACCACGAACGGGTAGAAGTGGTCGACCAGCGAGATGCCGAGCGCGACCACCGCCATGTGCAGCGCCCGCACGGGCGCCT
GGCCGCTCAGCGCCGACCCGTGCCACCGCAGCAGAATCCCCCACAGCCGCGACGCGTCGTAGTAGATCATCGCTCTGAGCTCTTGCTGTGTCTTGGACGG
CAGATTGAGGAGTGAAACCGTAGCCCAAAGATCGGAGCAATGGGTGCAACAGTCAACGGGTACGTGGCCGGTGTGTCTTCTGTTTAACTTCAACATGACT
GTTTTCTGTGTCGTATTATGTGTGGTTGGTGGGATATCGTTGGATCCGTGGCAGTAGCCAATAATGCGAAATGCTGCAGCGGGTGTTGGCTCGGGAGAAT
GTGGACGAGCGGCGGCGCGCGCTGTTTCAGGCTAGCGGCATCACGACGCACCGCCAGTTGCTGCAGCGCCCAGTGTGGGACGTCGCCCATGCCGTGGACA
TGTCCGTTCGCGAGACGGAGGTCTGAGGGCGGAGAAATTTGGGTTTTGAGTAGAGTGGATCATTATTCTCACGGACTGGTTGAGTAGGAGCTAGTGGCCA
AGCTCTCGATCCGACTGGCCCCAGCAAGTCGCTCGGTAGTGACAGCCCCTTGATTGAAGTTGCAAAGGTATTTGTGTTGTGGGTTGTTGCTGATGGTCTC
TGGTTGTGTGTCTTAGGCCTTCGACCTCTTCTTGGAAAGCGCCAACCACCCGACGTTCTTGCGAACAGGACTGGCAGGCATCGATCAAGCGCTGAACGGC
GGACTGCATTGCCGAGCATTGTCAGAAGTGCGGTTCTGCTGGTTATTGATGTGCAAGTTTAGTCCGGTATTTTGTCGCTGATGAATGGTGTTGTGAGCAG
TTTGTGGGCACTTCTGGTATCGGCAAAAGCCAAGTTGCCATGACGCTTGCCGTCATTTGCGCGATGGATTACCCAGAGAGCGGTGTTATGTTTTTCGACG
TCGAGCACAACTTCAGTGCTAAACGGTCCGCTTTTCGTGTATGTCGGTGTTTGTGGCGTAAACCTGACGGTGTGGTCGTGAGTGCAGTCTCCTGCAGATA
ACCCTTGCGCGCATTAGCCTGACAAGTACTGGCCAAGAGGCAAACTTGAATCAATTAGCTGCTGGAATCATCAAGCGCATTCGTGTGGTGAAAGTCAAAT
CAATCGCTGTATTAGCTTCCAAGTACGTGTGAGCTGCTTAAAGCATTGGTGTTTCAAATCCAGACTAACACCGTGCGTACCATTACAGGCTGAAGGAAAT
GGAGGATTCGATGCATTCATTCAGGGTAAAGCTCCTCATTATTGACTGCGTGACTACTCTCTTCAACAAGGTCAGCTAGGTGCTTGAGTCCCTTATGACT
TAGCGAATGCAATCCGCTTCTTGAGATAATTAACTTGTTGTGTTATATGTGCGATACCAGGCAAATGATTTAACGCACGCACAACGCCAACACCAAATGT
TACGGCTCGCAAGAGACTTGAAGTAGGTTGATCTGCTTCCCTCGTGCTGCTTTATGGTGGACTAATGAGTATGTACATCTGCATTCAGATTATTCGCAGA
CACATACCAAGCCTTCGCTGTCGTCACGAATCATGCCAGCACGGTTGAAGGCGAAGGTAGGCTCTGTAGACTCTTGTCTATCCCTGGTCCCATCGGCTTT
GTCTGAGTTTTAACTTGCTATTGCCGTCTAGGTGGACTGTATACGAAGCCGCAACTTGGCGACAGTTGGGCGCACTGCGTCACCACAAGGGTCGGAAAAT
GCGGTGGCTTTGTCATGGTTACTCGCTTCAACATCTATTAACACTGGTTGATGCATTGCAGCTCATAATGGAGCGACACTCGTTGTATCGCGCGGTGACG
ATCATAAAGTCATCCGTGGCAGGCTACGTAGTGCAGCCTTTCACCGTGAAGGTGCGAATCACCCCAACTTCTTCAAACTCAGCTCTCACTAACCACTGAC
AAGACCCTTCATGAATGTCTTCTTTCACCTCGCCAGTCAGCAACCACTAACGAGAGTCTCCATTAATGAATGTAGGAGAATGGTGTAGTGTCTGTCGAAG
ACGAGGAGCCACCAGGAGACGTGCCAGAGGAGGACTTCTCTATCCACGATGACTTACTCAGCGACATGGCCATCAGCGGACTGCAGACGGTGGACCCAGC
ATGCACTCTACGATCCACGCAACAGAGCAACGCAGAGGACCCGGACGCGACGCAGCTCATTGAGGGAAGCAACGAGGAATCGCAGTCACACGACCAAGAT
GCAACACCTGAAGCTGCAGTGGAGACTGATGAAACCAGCAGCTTCGACATCGTGTCCGACTCCAACTCGGAGAACGAGGACGAGTCTTTCTGCTGGGACG
TGACAGAGGAGTAGAGTAACCAAAGCACGGCAATGAAAATGCAATAAAGTCCCAACTACGAACCGACAATTGATCAACGCCGTGTCGAAACATGGCGGGA
AGCTTAGGAGGGTGTATTTAGTCCGACGCACGCCCAGCAACTAGCAGAACGCTTACGCCTTAAGAGCGAAGCGGCGCTTGGGGTAGTACGACTCCTTCTT
CTGCTGCTTGAGGGTCTTGAGCGACTTCTCGTGCTTGGAGAGCTGACGGCGGATGGCGCGCGTCTGCTTGCGGCGCAGGTCCAGGGGCACGTGCTTCTTG
CTGCCCAGGGCGTCGCGGAGCTTGGCCTTCTGGTTCTGGTTGTACACCGTCAGCACGCGGGCGATCGACTTGCGCACCACGCGGATCTTGCTCAGCTTGG
AGGCGGCGCCGCCAATGACCTTGGCCACGCGGAGCTGGGCCAGCTCCTGCTGGTAGTCGTCCAGCTGACGGAGCAGCTCAGTCTTGCTCTTGGTGCGGAG
CTCGTGCGCCTTGATCTGGACTGCACGCAACAGACACAAGAACAGTCAGCACTGCGGATCTCGTCGGCCT