Description :
From Genome Similarity Track
Location :
Scaffold_186:25317- 26485
Sequence
1168 bases(100 bases per row)
TTGTGCAATATTAGAACAACAATTGCAACTATCCCTGAGAAAATATAATGGCTGAATTCTCTTAAGCGCTTGATTCTATGAACAGGGGACGCATCACGTA
GTGCATATACATTCCTACGCTGAGCTATCCTTATGGTTTGATATGTAATCTTGGATATCTCGGATGAATTCTAATCATTTCGGATAAATATTAATCTCTA
TCTGGCCCTCCGCTTTCCTATCCATCCAATAGTTGTCCCTACCAAGTTATAATCTCTATAGGTGTTCACAGACCTTGGTATACGGCCGCTAAGAAATTAT
CGACTACTTATGGCTAGAATCATTAATATAACTATACAGATGGAATTTATGTATTTTTTGCTTCTTCAACATGAAATGGTTAATTTAAACACTAAGGTAT
CAGGCAGATTATGGCCGACGACCATTTTTTGGCCGATAAACAACAGTAGCCAATCAGATGCTAGAGCTGATAAATCTGAGCAATCTGATTGGCTTGTTAA
ACGAATGGGTCAGTTTATGGCCGGCCAAAAGCATCAAAGTAGGTTGATTACACATTGCAACAACTAACGATGAAGAGAATAAAGTCCTACAGAGAAGTTG
ATCTCTCGAAGGCTGTCAGTTCTCGTGAACATGGTGTGCACCGTCCGCGAGTTGTTTCTCACGATTTCAGAAAGAAAGATCTGCGGCATTATCGAGATGA
AGATCATTCTACTTCTTCTTCATCCAAACCAAAGACAAATTTTGCAGCTCTTAGATGTCTCCGTGTTTAAGCCCTTCAAGAACAGCCTCCGTCGCTCCAT
GGACCGCTTTATGATCGAGCTTGACGAAGGAACAGGAAATCTCACTTTCATTGAGCGCGTGGCAAAATATGTGCTTGCCAAGCCAGATAATGTGATTTCT
GACTATGCAAGCACTGGCTATTGGCCAATATCAGCACCCAAGGTTCGTGCTCGTAGAAAATTATACGCCGATAGAGGTGTTAAGAACGGAAGCGTACCAA
GCAACCCAATAGGGCTCACAGTGCGGCTGTAGCTCCGTACAAAAAATTCTTATTGCCCAAGCCGTCAACTTACTGCAAAGGAAAGCTCAGGACAGTTGAT
ATGCTCGATCGCATCATGAATTTAGAACAGTTGCAACATATCGCGTGGTACATTTGATTTTTGTAATA