Description :
From Genome Similarity Track
Location :
Scaffold_1:2531441- 2540327
Transcript NameFunction/comments
Phyin_T30-4PITG_00488Putative uncharacterized protein
Phyin_T30-4PITG_00489Putative uncharacterized protein
Phyin_T30-4PITG_00490Protein phosphatase 2C%2C putative
Phyin_T30-4PITG_004913'5'-cyclic nucleotide phosphodiesterase%2C putative

Sequence
8886 bases(100 bases per row)
CTAACTGCAAGTGGAACGACATGGGGATGACAGCAGAGATTCTTGGTCCGCCACGTCACTCGTCAACAATTCAAAGTGGGTGCGTCACCAATCCACTTGG
ATTTAGTAAGAGACACAACTTACCTGTCTATACCGATGGCATTCCTCCACCGCAACTAGCAGTCATTCTCCATTTACTCCCCACGTTCGCACGTGTATCG
AAGCCTTCTTTCCTCCCCAATTAATAGCAATGTCTGACCTTAAGGCCGATTTCGAAGCTGCTGCTGCGCTTGCCAAGACTTTCACAAAGAACCCCGTACG
TAGCGTGTCCCCTTCCGCCTCGAGACGACTCAACTGATCCGATGTGTATCATTTCTCTGTTTGACTCCAGACCAACGACGAGAAACTCGCCCTTTACGCC
TACTACAAGCAGGCCACTGTGGGAGACAACACGACGCCCGCCCCCGGCATGTTCGACCTGACGGGAAAGGCCAAGTGGAACGCCTGGAACGCCAAGAAGG
GTGTGTCCACGGAGGACGCCATGAAGGCCTACATCGCCGAGGTGGAGAAGCAGAAGGCTGTCTACGCTTGAAGTGCGGCTGCCAGGTCGCGTCTGTAGCT
ATGCCCCCCTCTCACTCAGTAGAGAAGGGGTCATTTCTATCCGTCTCCGCTTCAAGCAGTTTATGTATGCAGTTTTGAACGCTACGGGGAAAATGGGGAC
GATCGACCCGATGCCAGCTCACGTTTGAGTCGCTGATAACTTCGTAATAGTTTTCATGAAATGTTAACAGACGACCATGACATGTTTGTGTGGGTTCATT
TGGCTACCTGCGTGAAGATCTGCGTACACGACAAGGGCTAAGCAAAGTTTCGCATAGCAGGACCAGTCCACAGTCGAGATGTGGTCAACTGTACTTCCAG
GTAAGTTCATTGAATAGATAGTTACAACACTGACAGCGCCTACTCGAGATTGCTGTCAGTGCCTTTAAAAAATGCGAGACCTGCATATATGGATTCGACG
CGTTGGAGTGCAGAATCTCCTCCATGCTGCTGCCAGCTGCGCTCGCATCCGCAAAAGTGATGAGGGTGCTGCTACACGGCTCACTTTGATCCGCCACTTC
CGACCTTTGCCTCGACCCTTGCCTCCATTCGTGCAAAGTCAGTCATGAGCTTATTGATTTGATCCGTGTGCTGTCCTAGCTTGGTAGACAGTGAAATCTG
CTGCACCGCCAGTTGCTGCTGCGTTTCGGTGTTTTGAGTCAGCAGTCGCATGAGGAGTACCTCCATCTGCTCGCCCGCCGCTGTTGTCCCCATGGAAAGC
TGTGTCATTGCCATTGATGTGTCTTCTTCCTGGATTCCGTCGTTGTTGTCCAGTTTGGGCGGAGACAGTGACGACTGTGTTGAGGTCGATCCAAACGATG
ACATTGACGATGCTGTCGTTGACGTAGAAGGAGATATCGGCGTCCCGATCTTTCTTCTGCTAAAGCTATCAAGCTCACTTTGAGCCGCATCTTGGATCTC
TCCCGTGACTTCATGTGCTTTGTCACTGTCCTCAGGTTTCTCAGCCTCATCAACAGTAATGTCTTCGGGCTTTAACTGGTTGACGCCCTCAGTTGAAGCT
ACAATCTCCGTAAGGTTCTCACCTGCTGCCAAAGCCAGTCGCTCCAAAATGGAAATATCACACGATTCTCGCGGACGTGTGTCGAGGACGAAGACGCTGC
CGACAGCGTGGCCAGAGTTCGGGTCAATAATCGGGGCAGCCGCGTAAAATCGAACGCCGGCAGCTCCCGCGACGAGAGGGTTTTTCCGAAATCGATCGTC
CTGAAGTGTATCCAATATGACCATCGGTTCGCGTGCATACACTGTATAAGCGCAGAATGCGATCTTGCGTGGGATCATCTTGTGCGCCAGCCCCACACTG
GCCTTGAACCATTGACGGTGCTCATCTAGAAAGCTTACTGCAGCCATGGTACACGACAAACGCGCCTTCGCGAGATCGCAGACCATATCGAACGGCTTTT
CCGATTCCGAGTCTAATATTTTCAGTGCGTACAAGGCGCGGAGTCGGTCTCCTTCGTCAGCACTTAGAGGTGGACAAGGCCACGGGTGGGCCCACTCGGA
CGAAGATTCGCTACTCTGCTGTTCTGTCTGAAGGTTGCTCTTTTTAGTGCTTCTAGACTCACCTTCCGCGCTGAAGTGGCCTTCCTTTAGCTCCAAATGT
TGGCGTGCCTTGGGAGTAAGTGAGCGAAGCATTTCTTCACTGTCTGGCTCGGACGATGGACCGAATGCAGGAGAGTGTAAATGGTTCTGCAGCCACACGC
GAGACGCCTCCGACGTCACGCTGGGGAGTGGTGAAGCCGCATTGCTGGATCCTCCAGCGCGACTGTTTGAGTTGTTGATCACACACGACATGCACACGCG
AACGCGTGCGGTGCCGATCGTCGGATCCACATGAGCGTCCTTATAAAGCGTGCAGTTCTTGCATACGACCTCTCCGCACTGCGATATACCAGGAAGCGTC
AGAAACCACGACAAAAGAAAGCGTCGGTAGCATCAACTACATGTAAATCTTACCATACGACAGTGGTGTTTGCGACGGAAGGTGCCGAATGGTCTGGTAC
AGACATAGCACAAGTTGCGCTCGTGGTCGGCGACCCAGTCTGCAGAATCCACGAGGTGCGACACGAAAAGGTTGTCGGCCGCCATCTTGACTCGGTGTTT
TTAGAGACGGCGGATGAGATTAGCTAGTCGATGCTTCAAGAATACGCGTTGGCGTAGGAGCGGTATGTTTAGCACGCACTTCTCTGGTTCGGGAAAAAAT
GAATTCTGGTGCCGCCAGTGAGTGCCCTGGCAACGCGGCGATGAAGCGAAACGCCTCCAGCACTCGCCGACCGGGCGAGAAGGAGTCGGAGACCCCACGC
AAACGCAAGAAAAAATCGTAAAGTGGAGAGCAATTGGAGTTCCGTGGGTCTTGAGCGGCGGTGGGGCAAGTGGCGGCACGTTTTTTCTGGCTTGTAGCTG
TTGTTATTTTTCGATTCATCCCTCCGCCCAACGCTCGCGACCTCCATTTTTGCGTAACAACGCTGGTCGGAGAACGCTAAGGGCTTCAATCAAGAATATG
GAGGCCTCCAAACCCCGAATAAAAATCCCTGGAGCCGGAATGACAAGGTATGCAATTTAACACCGCGTCGTACGATCCGTGCAAGTGAACCCAGCCTAGA
AAGTTCCTCCGCAGAAAAGTATCACTAACATACACAGGGCGTGGTGGCGACGCGGTGACCAGCTTGCCTTTTTTCGTGACGGAGCTCTGGACGATATTCC
GCCGTACGAGGAAGCGAAAAAACTCTTGGTTGACGATACACACAAAAGAAATGGTGGACCAACGAACGTGCTACTGTGCACCATCTCCGGATTTGAGTTA
ACGATGAGTCATGAAAGCTACAGCCTCCTCTAACTTTCGCAGCTGCCATCTTTTCGTGGCGGTCTGCAGCGTATGTACACAACCAGTATCGTCATCAGTT
AAACTCTTGTGGACAGCTCAGCGCCAAGCGTTTCGTGGGTGTCGCTATTTCTCGTGAGCAAGTTTACGTGGCCGTTAATGCAAACACAGCAATGACGTAC
AGTACATGTACCATCCTCGGTTGATGCGTTGTTTTTCTCTCGAGACTTACATCTGGACTTCGACGTGAGAGACGCTACCCATGCAGAGCTGACTGGGAAG
CGTCTAGCCTACCGGTAGCCTACCGGCGGTAGGTGGACCAAGTGCTTACCACGTACATATATTGAGCATGCGCTAAAGCATTAATAGAGGCGAAGCCCTG
TGGTTAATTACAACCTAATCTCACTATCGGTTTAATGCATTCGTCTCCGTTATTTGCCCCCTTCAACTTGAACACTTCAACGTAGCAACGATACATTTTT
GACCAATGATCAAGCACTTTTCGTGTCCCCTACTTTTTGGCTTTGAGCAAACGACGAGAAATGCGGCTTTTTGCAGCACGGAACCTGGCCCGCTTGGCAC
GAGGACAAAGCCACAAGGTGAGAACTTTCTTCATCCTCCTTAGGCTACCTATCTCTCTGCTGCTTTTCGCCGTTTCTTCCGTCGTTTTTGACCCCCCTAG
AAGCTTCATAATCATCACTTCGATCTCACCTCTCGCTTGTCGTATTTTGCTCCAGTTCCATGGCCCCACGCTGCGTCACGCGCTACTTCTAAGTGGCCTG
GGACTGTCCATGCTAGCCCTCGCACGTGGAGAGATGGCGGACGTGCACTCTGCGCACATGGAAGCGCAGTGTGACGCTCGCTACGCCCCGCCCGAGGTGG
AGGGGGCCTTCTCTGTGCCTCTGGAGCGCGAGGAGTTCGCACCCATCACCAAATCCCGCGCTACACGAGTCAGCAGCGCATCGTATAAGGCAAATTTCCC
CATCGAGGACAAGTACGCAGTGGCGACGACAGACGCGGGCGACGTGTTCGCAACCGTGCTGGATGGCCATGGTAAACACGTCACTTTGTCTGGAGATCTG
TTCCCCTTGCTGATCTGCTTGTATGATACTTGTAGGTGGCTGGCAGGTGTCTGAATATGCTCGCAAGACGCTGATTGGCAACGTGCAGAAGGAGCTGGCT
TATCTGTACAAGCCGGGGACGTCTGAGCCGGCTCAAGGTGACGAGGAGGCGGTCTCGGACAACCGCGTAGCTGCTGCTATTCAACGTGCATTTGGTCGCA
CAGACCGCGACCTTATGGCAGAGGTGGCATCGGCCTTCAAGCTGGGTTTCGGAGCTGTTGCACGTTGCGGATCGTGCGCATGTCTGGCGTACGTGCACGA
AGGCACCGTGCACGTTGCCAATGCTGGTGACATCCGTGCAGTACTGGGTAAGCTCGGAAAGGAGCCCAACACGGTAGTAGCTGAGCCACTCAGTAAAGAC
CAGAACGCTATGGTGAAAATCGAGCAGGAGAAGCTCATTAAGGAGCATCCGGGTGAAGCCAACGCTTTCACGTGCCGCCACCCGGACTCGTGCTACGTGA
AGGGCGCACTGCAGCCTACCCGCGCATTCGGTGACTTTGCCCTGAAGCATCCGGAGTTCAACGGGCCGCCCTACAAGAACGGGGACCGCTCTGCTGGTCG
CCACTTTTCGGCACCGTACACGCCACCATACATCACGGCTATCCCGGAGGTTACGTCGCACAAGCTCTCGGAGGGAGACAAGTTCCTTATCATCGGATCG
GATGGTCTATGGGACTATCTCAGTAACGAAGAGGCCGTCGAAATCGTGAACGGTCAGGCGTCGTGTGGGAATCACGATCTGGCTGGACGTGCGCTGGTTG
AACGTGTGCTTCAGAAGGCGGCGAAGCGATACGGAATGACGTACCAGGAGCTGTTGAGTCTGCCACCGGGAAGTCACCGCCGTCGTCGTCACGATGACAC
GACCGTGGTTGTGCTGTTCTTCGACTAGAGTGAATTCAGGCGCCTGAATAGCCTTGACGACCAAGAAGGATTGTACAACTTGCAACCTTTAAACCATTAA
AGGCACGATTCAATCAAAAGATTGCCAACTCATTTATGATTTCTCAGGGTTGAAACTATAGGCATTGCGAGAAAAAGAAGATCGCCCTGTTCTACTGGTA
GTTTGCGGTGTACCTGGTAGCATTGATGTTGAAGGTCTCGTTGGTTCGCTCTTCTCCTTTTCCAGTTGTTGCCTGTACAATTCGTAGTTCTTCTCCAAAG
AGTCTGTGTAGAACTGCAGCAATCACATTATCAGTATGGACGACAGTGCAACAATGGCGACAAGAAACTTACCCGCAGATGATGGCAAAGTGAAGTCAGT
GGCAGCCAAATAGGCCGCACAACGTAGTTGATGAAGTTGAGATGCACGATAACCCGAACGTATTTATTATCGAGGTTTCGCATAAAGTAGTCGGTTTGTA
CTCCATGTTCAGCTTCAGTAGCTGCTTGGTTCTGGAACTCGTCAAGCAAGCGAGCACCCCACTCTTGGGCTTGAGAAAATGGTAGCAAGTAGTGGGATAG
GTCGGCAGCACGCACTAGAATTCCCATGAGGAGAAGACGCTTCTCGCTCAGTTGTCGACGTGTAAGACCTTCAAGAATTTTGCATTTCTCAAAATGTTTC
GACATGTCGGTTGCCAGAATACACGAAATGATAAGGTGACGCACTCGTTTGTGGCGTTCATGGTCGAGATGTTGCAGAATCTTAGCCGACTTGTGGTTAA
GGATGATGAAAGTTACCCGACAGTGGTGGCGCTCCAGTACTGCGTCGTCGTTGTGTGTGAGCGCCATGGGGCTCAACATCTTCAGTTCGAAGTCGTTATT
GTTTCCGGGATGATCGATATCGTGGCAAAGCGATGCTATCAGCATGGCGAAAATCTCGAGTCCGCTAAAATATCGACGACACTCTGTGCGTAACATGATG
TGCATTGCCACCATAACCTGAAAAGCGTGCTGGAAATTATGGAAAGGGTTGCTACGATAGTAGTTAGCCACGTTTGTCGAGAAGGCTGAGAATTTATCAC
TAGATATGCGGAAGGCGTCCATGAACCCGTACGCACGGAAAATAATACCACAGCTCATCGACACTTCGCCGCTTGAAAGTGCCACAGTCTCGGTGTCCCA
ATGATCCAGCGGTTCGTTTCTACCATGAGTAAAGGAAATCTCACGTGGAAACGGCACTTCGTCGTCTTCCTGGCTCTTCTTCTTGATAGCTGGTAGCAGC
GCAGCGAAAGAGGGGATCCCTTTTTTCTTTGTTGCATTCGCAGCGTCATCGCCTGAGTGGCAATATTTGTGTACGATGGAGGAAATGATGTCTGTCTCGG
AGAAATTATCCAGACGACTACTACTTGACATTCGCTTTAAGGTCCTTGGGTTCGAGTCCACACTCGTGCGAGATACAGCAACACAGTCGGACACTACTTT
GTAGTATGAGACGTCGAGAGACAACCGACCAAGTGCAAATTGAACTTCTGCGCAGTATTTACTCATGATCTCACGGTCTGTTTGTGTGAAGGCCACGACA
TGAGCACCTTCCTTCTTGTTGATACACATTGCAACAGCTACCACCTTAGGAGGAATTGTGACCGAGTGGTCTTCAAACACAGGCATACAAAGCACGCTCG
TAGTACGGTACCCTGTCTTCATATCAACACTCGGATCGAACAGCTCGTGCTTGTAGGCGTCACGAGTACAAACTGTTTGCCCGGTAGTGGCTACAAGTCC
TGAAATCCCTCGATTGATTGGCGAGCGGATACTCTCACCACCGATCCGTGGTGTGATCCAAAGCTCATGCTTGAAATGATCGATAAGCAACAGCCCAAAG
CGATCACAATCCATGATATCTTTGCCTATATCCATGACCATGTTGACGAACTCCGCGATATCGGTGCTCTCCGATATGAACGTCGTGAGCTTCAGTCGTG
CTTCAATCAGTTTTTGTGACGTTCTGACTTGACGATGCAAACTCGCTTTGTGTAGTGAAGTACCCACTGCTTCAGCTGCGTAATTCAGAAAAATAGCGTC
CTCACTGGTGAAATCCATGCCGTCAACCTTGTTGACTGCCGAGAGTACAGCTAATATCGTCCCCTCTGGAGACTTGACGGGCAGGCATAATATTCTCTTG
GTGAGGAACCCTGTCTTCTGGTCCAAGGTCGAGTCGAACAGAGGATGCGAGTACGCGTCATTCGTGATGACAGTCTCACCTGTACGGGCCACGTATCCAG
CGATGCCTTTTGTTATCGGGACATACTCCCCACGAACGATATCTGCTGCTGATGCGATGTACAGCTCATCTTCGCCTTCGATCTTGATGAACAAACCGAT
ACGTTCCGTGCCAATTAGTTCATGACAAACACTGAGCACCTGATCTAGAACTACCGACGAAGACACAGTCTCCATGGAAAAGTTGCGGTGAAGCTTGAGT
AAGCCTTCGATACGATGCTGAGCAGTCTGACGCTGACGTGAGAGCACGAGGTTCCAGATTGTGGCGCCAGCCACCACTGCGATGAATTCCAGATTCGCGA
TATCTGTATCGGTGAACGACACTCGTTTATCTGTTGATGACTTGTTAGAGCTTACTTGGAGCACGCCAACTACAGCACCATGAGCATTACGAATTGGTAG
ACAAACCAATGCTTGTGGGTATTCTACTGCATTATTATCACCGTGGTTGCGTTGAATTTGGAAGATTACATCAGTGTCGGAGTCGGTGATTGTAAACGGT
CTTCCGGTCATGATCACACGTCCAAAAACTGTGGGGGAGTCAGGCACCATGAAGCCTTCACTTATGACATCAACTTTCGAGAGTGACAAGTCTAACTCAG
CGTCGCTATCGGTGCGTAGGGTGGAACATACGTCCAGGACGTTGCGACGCTCGTGCAGAATACCCAAAGTGAGCTTGTCGGCGCGTACTAGTTGCACTGC
AGCACGTAGCGTGCGTTCCACGACGCTCTCGAAGCTACTTTGGGCAGAAACCTCCTTGGCGATGATCATGAGCGCCTCTAGCTGCGAGACGCGCTTTTGC
ATCGTCACGATCCCACCAGAACTTTGATCAACTCCTACCATTGTAGCGGGAGATGTCATTGCCGGTGAGTTGACGCCGCTAGTCGGTTCGATCTTGATGG
ATATGGCGCTACCACCACTGTGCCCAATAGTACTTTGCCGATGATCTAAAAGTCGTGACTCCAACGCTGCCGATCGACTACGAAGCAATTGTACACGCTT
GCGACTTTCTTCGATACGAGCCAGTAGACGTTGTTTCTCTGCAGTCTGCTCGCGAACTCCATCCACGACAGTTCTTAAGGCGTCTGCAGGCACGAACACC
ATCTTGGTCTTCTCCATTGAGGGCATGATTGTGCGATCATGTGGAGACGATAATGATAAGTTTCACAGGAGCAGAAACCGTTTCGC