Description :
From Genome Similarity Track
Location :
contig_50:253144- 258228
Transcript NameFunction/comments
g9919.t1hypothetical protein
g9920.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
5084 bases(100 bases per row)
TCCGCTATCATGGCCTCCCTGAGACTATTGTCTCTGACCGTGACCCACGGTTCACGTCTGCGTTTGGAAAACGCTGTTCCAATTGCTTGGAACACGGCTG
CTCATGTCCACGGCCGACCACCCGCAGACGGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTCCCG
GCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGTTCTCCCCGTTCTACCTCAACGGGCTCCGGAA
CCCCCTGGTGCCACTCACTCTCCGTGGTGACACCGCGGCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAAAGCTCTTTCCTCCCAGGTGTCAGACGTGACA
CCGGCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTAATGTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAACAAA
AGGAGTACTCTGACCGATATGGAAGAGGAAACTTAAACGTGTTTAAAGTGGGCGAGTTAGTTCTACTCGACACTAGGAACCTACCACTAAACTCGGTCAG
TTCCGTGCTCAGCAATAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTGAGCAGGCATGGCTCCGCCTACACGATCGACTTGCCTAAGTCGATG
ACGACCCACCCGACGTTTTATGTGGGTCGTCTGAAGCTGTAGCGGGGCTACACATTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACAT
TCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGG
GTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGC
TTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACA
CGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAAC
GCGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAA
CCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCGCCGACGGAGCAACACGGTGTTG
CTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAG
CAGTTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATCGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTT
GCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACATACGAAGAGTTCAAGG
AGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCTAGCATGACGTGCATGCTTACGC
CCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTG
AAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGA
ACGCCCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTG
GATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATAC
TGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAA
TGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTC
TCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTA
TTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACAAGAGAAGGAGTTCGTCGACGAGCTTAT
CGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGC
TTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATG
CGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAG
AGGGTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGA
CGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGAC
GAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAG
AAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCT
GCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAATAAT
CCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCC
TCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTT
CGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCG
CAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCG
ACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTG
GCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGT
ACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGC
TCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAAACGCCCCAGCGACGTTCAACAGGTGCGTCAGCACTTGTGGGCGCTCGGTGCGCGACTTCGCACCG
AGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGC
GAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGA
CCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTG
AGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCA
AGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACT
GATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTC
CTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCA
AGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGC
CGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTC