Description :
From Genome Similarity Track
Location :
Scaffold_186:25311- 26476
Sequence
1165 bases(100 bases per row)
TTCATTTTGTGCAATATTAGAACAACAATTGCAACTATCCCTGAGAAAATATAATGGCTGAATTCTCTTAAGCGCTTGATTCTATGAACAGGGGACGCAT
CACGTAGTGCATATACATTCCTACGCTGAGCTATCCTTATGGTTTGATATGTAATCTTGGATATCTCGGATGAATTCTAATCATTTCGGATAAATATTAA
TCTCTATCTGGCCCTCCGCTTTCCTATCCATCCAATAGTTGTCCCTACCAAGTTATAATCTCTATAGGTGTTCACAGACCTTGGTATACGGCCGCTAAGA
AATTATCGACTACTTATGGCTAGAATCATTAATATAACTATACAGATGGAATTTATGTATTTTTTGCTTCTTCAACATGAAATGGTTAATTTAAACACTA
AGGTATCAGGCAGATTATGGCCGACGACCATTTTTTGGCCGATAAACAACAGTAGCCAATCAGATGCTAGAGCTGATAAATCTGAGCAATCTGATTGGCT
TGTTAAACGAATGGGTCAGTTTATGGCCGGCCAAAAGCATCAAAGTAGGTTGATTACACATTGCAACAACTAACGATGAAGAGAATAAAGTCCTACAGAG
AAGTTGATCTCTCGAAGGCTGTCAGTTCTCGTGAACATGGTGTGCACCGTCCGCGAGTTGTTTCTCACGATTTCAGAAAGAAAGATCTGCGGCATTATCG
AGATGAAGATCATTCTACTTCTTCTTCATCCAAACCAAAGACAAATTTTGCAGCTCTTAGATGTCTCCGTGTTTAAGCCCTTCAAGAACAGCCTCCGTCG
CTCCATGGACCGCTTTATGATCGAGCTTGACGAAGGAACAGGAAATCTCACTTTCATTGAGCGCGTGGCAAAATATGTGCTTGCCAAGCCAGATAATGTG
ATTTCTGACTATGCAAGCACTGGCTATTGGCCAATATCAGCACCCAAGGTTCGTGCTCGTAGAAAATTATACGCCGATAGAGGTGTTAAGAACGGAAGCG
TACCAAGCAACCCAATAGGGCTCACAGTGCGGCTGTAGCTCCGTACAAAAAATTCTTATTGCCCAAGCCGTCAACTTACTGCAAAGGAAAGCTCAGGACA
GTTGATATGCTCGATCGCATCATGAATTTAGAACAGTTGCAACATATCGCGTGGTACATTTGATT