Description :
From Genome Similarity Track
Location :
Scaffold_323:25310- 27323
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_323-fgenesh-gene-0.3U3 small nucleolar RNA-associated protein

Sequence
2013 bases(100 bases per row)
ATCGCCATCTTTGTCGCCATGGGCAACCACGAGTCACTGCCGCAGATGCAGCCTGTCGCAGAGCTCCTGCTGGCGCTGAACGCGTTCGACGCCAAGAAGC
TCGAGGAAATCGACTTTGAGCGCCGCGTGGACGCGCTCAACCGCGTCAACAACGCCGAGTTCCAGGGCTTCCTCGGCGAATCGTACTTGCTCGCACCCGT
GATCAGTCAGTACCTGCAGTCGATGCACGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
AGCCCAAGTGGACGAGAACCCAGAGGTCGCCGCGAAATCCGTGATCCTGAACGCGCTCGAGTCGCTCGTCATGCCGTGTGTGCGCGTGAGTCTCAAGTCA
CCCACGGAGGAGATCCGTCGCGGCTTCGTCATGTTCCTGGGCAACCTTGCTGACCATCACGCGTCACTGTGTAGCTTCTCGTTTGTGCACGCGGACCTGG
CGCTGCTGCGCAACAAGGAGGACCCCGAAGCCGACTTTTTCTACAACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCACGCGAGCACGATGAGCAGCAGCAAGCTGGCGAGGACGCCATGGAGGTTGACAGTGA
GGCTCCTGCGGCTGCCAAGCAGCAGGAATGGTTCACCAACTCGACGGTCAACAACATCCTGCTGCCGCTTGTGCTGCACTTCATCTATGAAGCGCAGGCC
AAGAGCCAGGAATCGATCCGTACGGAGGCTGCTGCGTGCGTCGGCAGCGCCGCAGGTCTNNNNNNNNNNCTGCGTCGACTGCTCAAGTCGATCGACGGCC
ACGAGGAGATGGAAAACACGATCATCGTCGCGATCTGCGCCGCGATCGACCACTACCACTACCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAGTGGGACGGCAGCGTTGCTAAGGCCCATCGCAAGTCTGGCGACGAGGAAGCGGCGTCCAAGATCCAGGACAGCAT
GGAGGCGCAGGTGTTGCCGATGCTGAAGCGGTACCTGTTCAAGGGCGTGACCAAGAAGGGCAAGGAGAAGGCGTCGGCCACGACGTCCGTGGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGCGCCTCGACGTTCTACCTCGAGTTCCCCAAGTTGCTCATGAGTTTCGCGAA
GCTGCTCAAGGCCAAGGACGAAGCGATCCGTTCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGATGGAGCTCGGCAT
TACGTACTTGCTGCCGGTCGTGCAGGAGCTCAAGGCCACGCTCCGTGACGGGTACATGATCCACGTGCTGTCGTACACGCTGCACTCGATCTTGGAGAAG
GCGAGCACGATGCTCGAGGCCAAGAAGCCAAAGTCGCTCGTCGAGTCTGGTAGTGATGGAGGTGCTGCTGAGAGCGAAGCCACGTTTGCGTCGCCACTGG
ACGCATGCATCCCGAGTATCATGGACATTTTGGTGGAGGATCTGTTCCGCGGCGTGATCGAGAACCAGGACGGCTCGGCTGAGCACAAGTCCAAGATGAA
GGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCACGCCATCATCGCGTCGCTCGTGCGCAAGTTTCGCGAGCACGAGAACTCCAAGTCGACGCTCGTGCTGGCCGAAGCGCTCAAGCGTNNNNNNN
NNNTGGGGCTCGTCAAGAACCCGAGCGTCGAGACGTCCTATGTGTTCCTGTACGTGCACAACCTGCTGCAGTCGTGTCTCGAGAGTCTGCGGCCGTCGAC
GGAGCTCGAGAAG