Description :
From Genome Similarity Track
Location :
Scaffold_1793:2531- 6422
Transcript NameFunction/comments
Phyta_totarag13664hypothetical protein
Phyta_totarag13665hypothetical protein PHYSODRAFT_340908
Phyta_totarag13666hypothetical protein

Sequence
3891 bases(100 bases per row)
GACAACGAACCCTCGTTGCAACCCccagaagctgcaaaacaCGGTGGAGAACCGGGTGAGGTGGCCAACGAGGGTTCATTCAGCGAACTTGCGTCACACC
ATCCCTCCAATACTGTGTTATCAGCAGTACCAGATGCTGAGGATGTCGAGCCAGTGGAGGTCCAACGCGAACGATGGAAGCGGATTGCAAAAGCTCAGGA
CGAAGAACTGAAGTGGTCGAACCTTAAGGTGGTGTTGAAAGGGCACGCGGAGAAGCTGAGTTACAAAGATGCCCGAGATGCATGGATATATGCTGATCGG
TTCGTTCTATCAGAGTACGGTGTGCTTCACTACCTTGGATTGAATCGTCGTTATGACAAGGGGTGGCAAGAGGAAACCAAGCTGCGTCTAGTGGTGCCGA
CAACGATGATTCAAGAGGTCCTGCAGAACTGTCATGACTCGCTGGAAGGTGGCCATTAAGGTGTTGTCCGAACATTTCAACGCGTTAAGTCCGATTATTA
TTGGGCTGGTCTGTATGCTGACGTGGAGAAGCATGTGAAGTCATGTCCGGACTGCAGTTCGAGTAAATGTCGACCACAGCTTTGAGGTTACTCGCCAGGC
AACGTGTTGGCTGAATGTCCGTTCCAGATCGTGTCTATGGATGTTGTAATACCGCTACCGAAGTCTCACAGGGGCAACACAGCACTATTGCTGTTTCAGT
GCTCATTCACTGGATTTGTTATCGTCAAGGCTATGTCGGACACCACTGCACTCAGCGTGGCCCAAGTGTTCGAAGGGAGTGTGTACCGACGATTCGGAGC
ACTCTCGTTGATCAGGCATGACCGAGACCCACgcttcatgagcgaggtTTTTCAAGCTTTTGCAGAAATGATGCAATCGAGGTCTCGAGCGACATTGAGT
TATCGTCCGCAAGCTAATGGACAACAAGAGCGGTCAGTGAAGTCAGTAATGACTTCAGTGCGTGTATACACTGAAGATCCTCTCCAGCAAGACTGGGATG
AAATTGCCGAGAGGTTGGTGTTCGCTATTAACACCTCTCAAGACACAATGAAGAAGGAAACGCCATGTTACCTAGTTCATGGGTGGGATGCGCGGTCTAC
CCTCAAGGCAATGTCGTCATCACTCCAACGAGGACTCGGGAGGCAGACTGATGCACTAGCATGGCGGCGTGAAGTCAATCGGCAACAAGAAATTGCACTG
GTTATGACCAAGGAGTATCAAGCACACGAGAAAGAGCGTCGAGCAAAAGAACACAATGATGCTTTAAGTCGACTTGAGAAGGCTGCTGTACCGCGCCCAA
GTGGAAATGAACCCTCGTTAGACAGACcagaagcttcagcaggtGGAGACGATTTTATGGAGGGTCCAACGAGGTCTCTTTTCAAAGATGGGAGCAGAGT
CTGGCTTTACATGGAACGAGTCAAGCCTGGGTTAACCAAGAAATTGGCTCACAGATGGCACGGCCCTTTCCAGATCAAACGCAAAGTCGAAGAGTTCGCC
TACGAATTGGAGTTGCCGGACCGGAGTGGATACAGAATCTACCCAGTGGTAAATGTGTCCAGGTTCAAGGCAGTTAATGAATTTCCAAGCCGTCCGAAGA
CTCGGTTGACGCAAGATGTGACCGAGGAGCTGCGAATTGACTTTGATGAAGAACTACTACCGGAAGACAGCTGGGAACCAGATCATGTTGCTGGTGAATA
TGAAGTGGAAGCCATCCTCGATCATCGTACACCGTTGTCAACAAGCACCGAGCGTTCAGTACGTGAATTCCAAGTGAAGTGGGTTGGTTACGACGACCCA
CCTTGGGAACCAGCGTCTCATTTGTCGTGTGGAGGCTTGCTGTATGATTACCTGCGCGCCAAAAAGAGTGATCGGCGGCTGCAGATGGTGCAAGTCCCCG
ACGAGGATTAAATTGACGTTGTCGCTTGTGACCTGTCCGTAGGGCGGTGCAGCCTGCGGTAACAGACGAAATTTACTACTGCACCAAACATTGTATATGC
ATTTGATGAATTACGTGAACTTGATTTCGCTGTGGAATATGGATTAAGAAAGACGAACAAATATGCACTCAAACTAACTACCAATGGAAATGAAGACTCG
GTGACGGCTGTAGAAGCTTGAGAAAGACCAGAGGAAGATGACTGGGGCACTGGCGAGGATTCAATCATGAGCCATGCGCCCAACAGCGTCAGCCAAGATG
TCCAGACGAGACGAATCTTCATCtctcttctcttcttcgtcaggaGATGGTACAGGAGATGATGGAGGGGCCGCAGGGCTGGAACAACCCGCGTTACCAG
TGGGGGCAGAAGCTTGagctgatccagcagctgggGTCGATGACGGCGAAAAGAATTCATCAGCCCAGTAATCCACGATCTCGGTAGAGCCCAATGAAGG
GTCGGCGATGATTGCACGACCAATTGCCGTACGCGTCATACCACGAGGCTGGAATAACTCAGCACTTGCGTTACATGGAAAGTACGTGGTGTTATAAGGA
TGTCGGTAGGGTACATCCATCCATCCTCAACGCCAAGGCTGCACAATGCCCACAGAACGAGCACCTGCAAACTGGTCAGCGGACCTTGGTATGAACGGCA
AATTATCCACCGAATATGGAAGCATCAACGGTTCGAAAATCATCTCCGGACGAATCTCCGAATTACTTGGACCGTTCACCGCTTCCAGGCATCACTGCCA
ATATTGTAGCTGGTACATCTGACGAAGCCGGTTGGCACGTTTCGTGCGCGCAGTCCGGTAGCGAACCCGAGGTCAGCCTTGGAACCGTCGCCGCGAAGTC
AGCCCACATAGCCTTGAGGCGAACGGGGTAAGGAGCACGCTTGGACACCGGAACAGACGGGTCAAAGCCAGCAGTGTCGAACAAACATGCTTGAACCGGG
AAACTCCGACGAAGCACCTGCCACGGGTGGTCCGGATCCTCGTAAATCGCGAACTTGTCGATGTCATCGGCCGTACACGGAGTAACGTGATCGGCCGGAA
CAGGATCCGGCAAAACTCTATTGACCAAGCAAAGCCAGCACTTCCTGGCTCCCGGGGCCGTGAAAGTCATGTCCAAGAATGGAGTAGCCCAATTAGGAAT
GATCGCGGAAGGCCTGACGGTGGGCGCAGCTCCATGAACCACTTGGTGTTGTCTTGGTACAGGCATAGCGGTATCTCGTCCAGGCCCTGGCCGGGAGGTG
TAAGTCACCACAATTACGCGACCCGTAccaggaggacgaggcggaGCTGGTACAGGAGTAGCAGGTGGTGTGACGGGACCTTGTTGTGGTAATTGGCTTC
CGTCATCATCATGAGAGTCGTTTGAACCCTCGCTGGCCGGTGGAacatcatctccagcaggAATATTATTTATTGCGAGAAGTGGCCAACGgatgcagcg
cctccagTTCCACATGAGTCATCGTTACCATGCTCTCCATTGTCATCATCGGGAGTACTGGACCAGGCCTCAGCAATCATACCTTGGCCAGAACCCTCGT
TACCAAGCGGAATATCTTCACCAGCAGGAGTGTCCCCAGCTGGAAGGTCAATCGAGGCTTCATCACCTCCACTTCCAGCTGGGTCGTCCTTATCAGGAGC
ATCCTGGTCATCTCCAGGGAGTTCATCACTTGGACGGCCAACTTGGGACTCAACTTGGGCTTGGTCTCGGGAAGGACCACTTGAAACCTCGCCAGTAGGC
TGATCAGCTTCACCAGTCGAAGTTATGTCTGCTGGAGACCCCTCCgacgcttcatcttgaggCTCGGAGCCTGGAACAGCTGAAGGCTCGGTCGAAGACT
TGACGGGCAGGTTATCCGATGCATCAGAGTGGTCCGagccttcttcctcatcttcgtcgtcgcttgggCCAAAAATTTGACGAAACGTGTC