Description :
From Genome Similarity Track
Location :
contig_55:253072- 255435
Sequence
2363 bases(100 bases per row)
CATCGACTGTCGTTTTGGCAGGCGTTCGGGTTCCTTGGACTCCCCATGCTGGTATTCCTTGTCTTTTCCATTGCTTGGACGGGGTGGTTAATTATCATGA
CCCTCGCACCCAATGAGACCGCAAACTACCTTATGAACACTGGCGAGTACGACGGTGGACAGTTCTGGTTGCTCGTGGAGCAAGACAAAGGCATGAAGTT
CGTCAGAATTCTTGGGCTCATGTTGGCCGAGGTTGGCTACTTTCATATTTTGGCGAAAATGCTGGTGTGGCGTACGGTCCCAGCACCATTTGCTGGGAAA
GCAGGAAAGTTGCGAAAGGCCAGTATCGAAAAGAAAGGAGTGCCCCAGCCGCGACCAAAGCTCACCCCCAGAGAGTTTTTGCAGGAGCTGACAGGGATCA
ACGGATCATTTCGCAAATACTGGGTAAGTACATGCCTTTTCATCACACTTACAACAATCTAACGGGTTACTCCACAGAATGTAGTGCACAAATTAGCAGA
CCTGACTACGCAAGCAGTTTTACTGAACAATTATCTTGAGAAAGGCTTTCCAGTTCCATTGGTTTATGGATGGACCATGTTCATCAGTATGAACTGCTTG
TCGTGCGTGCATAGCATCTTGATGAACAAGCATTCTGCTTTAGCCGAGATTCTGCTCGACTCGATGTACGTAAATTGTCTACGGGAATGGGAAGATGATT
TTGCAGGGTTAACCTTGCGTTTGGTCGGACAGGTTTGACCTCGTCGCCACAATTGTATACCCCATGGTTGTGCTCATTTACTGCTATCACAACTTCGTGT
TCGATCACGCCGTATTCCGGACTTACATGCAGGTATTGCCTCCTGGGAGTTTCGAGATCATCGCTCGTTTATTTGCCGACCCAGCGCAAGTGGAACTCTT
TCGAGTGAACTTCAATTCTCTTCGAGACGAAACGCCGTTGCTTCTACTTATTCATCTGTTGATGAACTTATCTTTTTGGCATCGCTTCAGGGGAGTCATC
GAAGTGATGTTGAAATCCAATCGCCGCCTAGTTTACCCCAGGCGACACACTAACTTCCACGCTCGACTTCAAAAAAGGGTACCGAAACCATGCGCCGTGT
TCTTTATACTTGCCAGTGCACTGGTGGTGCCGTATGCTCACTATGCAATCGAAGCATCACGGACAACATGTAGCCCATACGCGGAGTGTATGGTATACGC
TTATCGTTCTCCATGGATTTCTGCAAGCCGTGACGTTTGTCCCTGTCGGACTCTAGTTGACATCGACAAGGCTCCCAAAACATTTGACGAGTGGATTAAT
CCCATCGATGTCACAGAGAAAGTGAAAACGCTCTCTGCCTCTGGTGATCTCAAAGTACTTCGGCTGATGAACCGACAGTTGTTAGAGCTGCCAATCGAGC
TGCAGAATTGCCAACTCGAACACTTGTAAGTCAACAATAAAATGCATAAATCTGCGATCATCTAACCTCAACATCTCTGTTTTGCCCCCAGGTCTCTTAT
TTACACGTCGATCACCTCTTTTCCAGATTGGACAAAGCACTGGGACTCACTCGAATTCCTGTACGAACGGTGATAGAGGGAGGATCTGTCACAACAAAAC
CAGTCTAACAATGACTTCTCTTTTGCAGACACGTGGAGGGAAAGCAAGGAAGCGAAAATCTGGCGTATCTACCGAGCGATTTGTTCAGCAATATGCCGGA
TCTAGTGTTTCTCCACTTCGCATTACACAAAACCCTGAAAAAGCTACCGGCACTACTCGGAACACCGAAGCTGAAGACATTAGAAGTTGCTCATCTATTT
GGTCTGACGAAGCTTCCTGACCTGGACAAGACCTTGGATTTGAGAGGCATCGTGATCGCATATCTTCCTCTACTCGAGACACTACCAGAGCTGCTGCACC
TAAAATACTTGACCAGCTTGACTGTTTTTCGCCCAAGCTTCCTGTGCTGCAACGGATATCTTGGACCGTGTGATTTGACCCATCCGTTCTGCGAGGCGGA
CCGAATACATGGCTTTCCTGCTGCTGCGTGTTTGACCGATGATAAGGTTCGAGCAAGCTCGGCGATGGTGAAGTTTCTCCAAGGTTTTGGTCCGGCAGTT
TGCTTCAAGACGCCAGACGACCTCCTTGAATTTGCAGACATCCCAACGAAAACTTCAGTGGATATGTGCGATGGCGTTCCCTATCGACGTTGTGAGATTA
TTGACCCTGAACGCAGGGAGACGTTCGTAGGCATGTGCTACAACCTCCGCATGCAAGTGCTTTCGTGCAATCCGGACCCGAACTATATCACCCTTCGCAA
ACTTCAAATTAGTTTGAATGTTGGCACGCCTTGCGACGTCAAGGAAGAAGCGTGGCTTGGGTG