Description :
From Genome Similarity Track
Location :
Scaffold_155:253- 1667
Transcript NameFunction/comments
g17524.t1hypothetical protein

Sequence
1414 bases(100 bases per row)
AAAGTGATGAGACTTTGTGTCCCGAAATCGCAGCGCAATCATCTAAGGACGAAGATTATTGAGCAATTTCATGATTCCAGTATTGCCGCGCACCCAGGAA
TTCGTCGTACGTACCTCCGTATCAAGCAATGGTACTATTGGGCGTCGCTTCATGAAGACGTTTCTGATTACGTGCAAAGTTGTGAAACATGCACACGTTG
GAAGCACAGCAACGCCAAGAAGAATGGCAAGCTGATTCCAATTCCGATTCCTAAGGAATGTTGGGAAGTCGTCTCCATGGATTTCGTTACTGGATTGCCA
GAATCAGATGGCTATGATGCTATCATGACCATCGTGGACAAGTTATCCAAGCGTCCGATCTACTGTCCCGTTCACACTACCGATGATGCCAAAGAAATCG
CTCATTATTTCTTCGACAACGTCGTTCGGCATCATGGAGTGCCTGCAGTGGTCATCAGTGATCGTGATCCCAAATTCACATCGCGATTTTGGAAATCTCT
CGCGCAGGTCATGGGTATACAATTGAATATGACAACGTCGTACCGCGCTCAAGCTGACGGCCAAACTGAACGTCAAAACCTGGTACTAGAAGACGCACTT
CGTTGCATGGTCTCGTATCATGGTAATGACTGGGCTGCCAAGTTGGGGACGATTGATTATGCTCATGCCACGCTAGTCAGTGCCTCTACAGGACTTTCGC
CATTTGAAGTAGACACAGGGCGTAAGGAACGCAATCCCTTCGGAACTTTTCCTACGCTGTCTACCACAGTTCAAGTACAACAAGGACTGTCTGAGTATGC
AAACCGCTTCAAGGATGAACGTGACAAAATTATTGTCAAAGCCAAGGAGCACCTACTCAAGGCTCAAGCATCGCAAAAGAAGTACTACGATCAACACCGT
AGCAATGTGCAATTCAAGGAAGGAGATTTGGTTATGCTGGATACACGCCGTATTCCACTCAAGCATGCTGCGAAAGACATTGACGTCAAACGTGCAAAGT
TAGCTGCTCGTAAAGTTGGTCCGTTCGTTATCAAGCGCATGATCAACGACAACGCTGCTCGTCTGATTTTGCCACGCAGTATGAAGTCGCTGAACCCTAC
TTTCAACGTAGACGTTCTCAGCCATTACGTCTCCAACCCGGACAAGTTTGAGACTCGTGTTCTTCCGAAAGCATCTCGCATCATCACGAATGAAGTCACT
GGAGAAGACCTCCACATTATCGAGAAACTTCTACGCAAGCGTCAGTTCAATCGCAAGACTGAGTGGCTTGTCAAGTGGCATGGTCTCCCAGACCACGAAT
CTTCGTGGGAACTCGAGAAAGACATCAAGCACGTCTCTCACTGGAAAGTTCTCGTCGACGACTTCAAGCGCCGTCAACGTGAAGTCAAACCCGGGAGGAT
GTAAGGACCGAGAC