Description :
From Genome Similarity Track
Location :
Scaffold_25:253- 1659
Sequence
1406 bases(100 bases per row)
TATCTATTCGATGTGCCCATCGAACAGGTCCTTCGCGAAGCGAGTTCAGCTCATTGCTGGACACCTGCGTCGGAGGATTCTTCAATTGCATTGACCTGTA
CTGAAATGCAGTACAGGTCCGCGTCAAGACATTCAACGTCTCGACCCTCGACGTCTTCTCCAAGGTCTGCCCGGCAGACATCTCTCGTAGCAAGTCTTGG
TCGGGGACAGAGACTTACGAAGTTTGTGTCGCTTACGACATCATTTTTTCTTCTTGTGAAACCCGGCTTCACCTGTTTCTCGTCCAGGCTCGGTTTTGAA
CGTATTTCCGTTGATGTAACCGTCAACAGATTCTATCGGCGGACGTGAATGATCAAGTTCGACTTGATTGCATTCCTCTTCTTCGTGCAGGTCGGCTGCA
CGTGAGCATGCAAGAATTTCCAGTACTGGACGTCGGTAACCGCCGGCACCGCTTGCCGCGTCGCCACCTCCCGGAGTTGACGCGCTAATGTCTCCTCGAC
GCCTTGCGGCGGAGTCCCTCCTCGATATGGATATCAAGTTTGTGTCGACTCCCATGTCCTTGTCACCTCGATGCCTTACGGCGGAGCCCTCCGTGATTGT
TGTCCAATCACAGTCGTGCCAACTCCCCGAGCTGACACACTGACATCATAGCTACTGCTTGTAGCTGGAGTCCCTTGCATATTCGATGCACCAGTTCCCG
GAACTGATGCGCTATCGTCACAGACATTTTTTGTGAGCGAAAAGACTATCTTAGTTAATGCATCGACTCCCTGAGTTGATACTTGCATTGAAGTAGGAAG
ATATCTCAAATCTGAATCCTGATTTGGGACAGACCCAACAACCGCCGCAGTCGCTGTGACTTGCGTGTTAGCACAGGAGGCAAAACCTTTCCGCACTGCA
TCAACGACGTGGTCGGATGCACCGTGCGATGCATGCGATACAGTGGCAAGGTCATCGCTGTCTGTCGCGTTGCGTCCGAAGCGTACAAGCGTATGCTTCT
CGCACTTGTCCACTGAATTATGCCGAGCAAGCCACAGAATACCCAACACTAAGTCAAACTTATCGTCTAGATCCAAGACGATAACGATCTCAACAAACTT
TCGGTGTTTGTACGACGCGCTTCTCCGTCCTAGTGGTGACACCGGTTGCCAACCGAACTTCCAAAACATTTAGAAGTGTTTAATTTCCTCGAAGTTCAGC
TTCGGTAAACTTTCCTGTCGGAGAAGTTGTTCGGCGCAGCTGAGGCTACCCAAGCACGAAAAGAGCCTGCTCTGATCAATCTCACCTTCAGGATGACAAG
ATTTGGCTTGTCATCTTGCTTCGTACAGCGAGAGCGTCTCTCGCTTGGGAGCTGCAGCCTTTATCGCTGCGTGTCCATTGTAGACACGCGTGCACCCGGC
GCCTAC