Description :
From Genome Similarity Track
Location :
Scaffold_2:252993- 255552
Transcript NameFunction/comments
Physo_110467predicted protein

Sequence
2559 bases(100 bases per row)
TAGCGAAGACTTCGAAGAACCAATTTGTTGTTGATATACTTGTTGTGATATTTCCCTCGATACACTTCCGCAATACTCGAACACTTCCAATGACAAATAT
CGTGTTTGTGGTTGGATTCATTCGAGATCGCGCTTCAGCAGCTTCCCCACTCAATGTCTGGTGCTGTGTTCTCTTACCGCTGGAGATTCCCATGATTTTT
TTTTTCGCGACACCGTATCCGAAGCACTTACGAAGCATATACGAAGAGGCTGTTGCGGATGGAGACGGCCACCTCGTTCAGTGACGGGTGCCAGCTGGTC
TGCAAGATCTTCTTCGAGAAATCCAACGCGTCTGGGTCGCCGGGAGCGGGCATTGCGGCGATCTGATGCGCGAGGCCTCGCTGCGGCATTGAGTGGCGAC
GACTCACACGCGCGGTGCGCGGGGTGATCGAAATGTCGGCGCGCCCATAGCGGTCATAAATATGGAACTCGCTGTTGTACGAGCCCGTGATGAAGTTGTT
GCCGTCCCCGCCAACCGCGCACTCGAACTTGTCGAAGATACAGTCGCTCTCGTACAGATCTCCCAACCGTGGACGAAGGTGTTCGTGAATCTAACCACAA
AAGATAATACGTGACTCACTCAAGAAAACGCAAAATGCAAATACCCCGACAACTTACGTTGATTGTTTGGACAGGACGCGAGTTCATGTTAATGTCCCAG
ACTTTCAATGTTAGGAAGTCGCGCGCAATAATGTAGCGACCGTCCGGAGAAAACTTGATGTCCGAGATGGAGGCAATGATTTCAGAGAAGAAGCTTCGTG
CCTCGGGGTCCTCCTGCTCTTCAAACACTGCTTTCCATCGAGTTAGTGCGAACTGAGCAAGGCCACAGCAATACACAAAACGTGCTCTGGGCGATGCGTA
CCTTGGGAGTACGAGTCGCACAGCGCTGCCTGGCGCATGTCCCCAAGCTTGATGGACCCGCGACTTGTGCTGTACATCATCGTGTTGCAGTGTGTTGGGT
GGAAGTCCGCAGCCGTGATAACCTCCGTGAGCTCCTCCATGTTCGCTGGCTTGATGTCCACAATGTCTATCCACATTTGTACAGTATGGAAATGATTGGG
TTAGCTTGCATCTTGCACATTCGGTAGGAAACAGCCTCAACAACGTACTGAAGCTTTGGTCCGAGTTTCCTAAACTCCAGAGGTTCACGCGCAGGTCGTC
CGCCGACATGAATGTCTCTCCGTCGCTGTTGATCGCGATCGAGTTGATGTGGTACGTGTGCGCGTTCGCGTAGACGCGCTTTGCGGTGGATGTTGTCACG
TGGCCGCGGACATGCGTTTGCGGCAGACGAATGAGTGCCGGCGTAATATTCGCCCGCGGGACGTGGGCGAGGCCTTGCTCGTTGAACGTCGTGACCTCAC
GCACACTGCGCTCGTGGATCTTCCACAGTTTGATGGTCTTATCATTCGTAGACAGTAAGCACTGGGACCCGTTGGACGGTCGGCACCACTTGATCTGGTT
GATTTTCTCCTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCGTTGTGGCTCTGGAACTCGGTGTAGAGCTGGTACTGCGGGTCATTGGAGCCGCTG
CTAAACATGCTCTGGTTCTAATTTACGAGAAGACGGTTAGAAGACAGTCTGCGATCCAATACATCAACCAACAGCCGCGACTGACCGATGCTGGATTCCC
GTGGCGGCAGTAGATGGAGACGCGGCCGCCTTTGTTGCCTGTGGCGAGGAAGTCTCCCGAGCGGTCGTACTCGATGGCGGAGATCACCTCGGCTGCATCA
ACCACCACCATCAAGATGTGCACTCAATAACCCGTTTGTTTGACTCCTGCAATGCGGCGGTCTAGATCCCTTACCTTCCACGAAGCTGCGGGCGCTCTCC
CCGGCCGAGAAGACCTGCCCCCACTCGGCGTCGGCCTCGTTGGTCGAGGGTTCGGCCATGTTGACCTCGAGCCCAGCGGTCGTGTTGTGCTTGAGCCTGG
TGAGCGCTCCCACGCGGGTCTCTTCTCCTGCTGCTGCGACGTCCATAGCTTGCGTCATACAGAAACGCGGGGGTGCCCTGCTGGCCTGGAAACAAGATCT
CTCGCTGGAGGTGGCGGCGCTGCTGTCGACGACGACTCGTCCGGGGATCGGGCGCTGCTCTCTCTCCTTCTCCCGCTCTCTCGGAGGATCTCGGTCTCCG
TCGGTGGTTTCGCGCAGAGGCGGAGGGGGGGGTTTCGTTTCTCGGGTGTCTGCAGACGGGCAGAGGCGCGACCACTTAGGAATGGGCGGCAAGCGGGGGA
TTGAGGCGACGGCGTTTCAAGGCGCGCAAATCCACGCGGCACAGGCTGAAGCACGCGCGGGCTCTACGGCGGCAGTGCAGTGCGGTGGCCGACGGGCAGG
CAGCGAGGCGAGTGCGCGGCCTGCAAGATGATCGCAATGACTCGGCCGGACCAGACGATCGCGATCTTCAATCGCATTTTTGTTCGCTTGGCCAATCGCG
GCGAGTGAAGCCACTGCGATTTCCGCCAATCAGCAAGCGATCACGCAAAAATCGAAGCA