Description :
From Genome Similarity Track
Location :
Scaffold_19:252945- 254761
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007648Similar to nek3: Probable serine/threonine-protein kinase nek3 (Dictyostelium discoideum)

Sequence
1816 bases(100 bases per row)
TATTCTATTTCCTCGTTCACAGTGGCGACCAGCTGGTGAACAACACAAGCGCATGGACAAGTCCGAACAGCACCCATGCGCGTGTTCGGTGGTAAGTTGC
TTCCGCCCCCTTTCCCCGATTATGGAAACCGAGGCATTTCGATTGTTCAACCAACACGGTCACAGCGAATGCGCGCGCTGAACAGTGTCCATAATCACTT
TCAGAAAATGGTGTCGCACACGCTCGTGTCTTTCTTTTTTCCTACAACCAGCGAAGCAATCAGTTGGACACCCGACCCGATGACTCGATCTCCATCATCA
ATCCTTGTAAAAAAACAGCTTTTTTTAGAAAGTTTGAAATAAACTACTTTGTTGGTGCTGGTCACCATTTGTTGTACAAAGTACTTTGTTTTAAAAATAT
TCATGTCTCAGCAGCCAACAAAAGCCAGCGAACCCATAAACTGCTTGCTCGCTCGCTCGTCTGTCCACCACCATGGAAACACGCCCACGCAACCCTACTA
CAAGCTCAACTAATTCCTAAGTGCGCAATATGCGAACCTAAGCAGCCATTGCAACTGTTGGCAGCACTCTCTTTTAGTTCTGACAGGGTCACTACAATGC
CAGAAGTCCATCCACTTTCGCTGTAGTCAGTCATACATCCTCTATAACCTTGCATAAATGATCTATGATGTTACCCCAGTAATGACTACAATAGCTGTAG
TAAAAAGGCAATACTGTCGACCGTTTATCCGTATGATATGATAACCTGTTTCAAAAAGTACATATCTGGTAGGCTACATGCAAGCGATCCTCAATAAAAA
GGGGGAGTGATGGTCGTGTTTTTTCTTTCTTTTTCTTTGCGCTTTTTTTTTCTTTCTATCGGGCATTTCTGGGTCCACGAAGAACACTCGAGTGTAGAGA
AAGCCTGTCGCGCATTTTCCGCATTCTCTCGCGCGCCGCCGTTCATTCGACCCTCCTCCTCCAGAGCGCGCATCTACCACTACAATAGCAACGGGTGCGG
TGTATATTCATTTATATCCCCCTCCCTCTGTTCGTCCCTCTTGTACCTTTGCGGGCACACTGTTCGGTAATTTACGCCTTTGGATCCACCAGTTGGTCTG
CAGACTTGAGCCACGATGGATCCGTCGGAAGTGTCGGTGCTGGTCGTGGAAGATGACGAGTTCACGCGCATGGCGACGATCGACATCCTGCGCAGCTGTC
GGTACCAGGTCGTGGCGGTCGAGAATGGCAAGCTGGCGCTCGACCTGCTGCTGAACAACCACGGCAAGTTCGACCTCGTGCTGTGCGACATGATGCTCCC
GGTGATGAACGGCCTCGAGCTGCTTGAGGAGCTGCAGAAGCACAGCACCACGCTGGGCCACATCCCCGTCGTCATGGCGTCCAGTAATGAAGGCATGGAC
GTCGTCACGTCCTGCTTGAGCAAGGGCGCCAAGGACTATCTGATCAAGCCGATCCAGGTGAACACGGCCAAGACGCTCGTGCGCCATGTGTGGCTGAGCC
GCCGACTGGAGCACACGACGACCAAGTCGATGTGGCAGGACATTGAAGTGCTGCGCACCATCGGCAAGGGAACGCATGGCACAGTCGTGCTGGCACGACG
AAAAGTGGACGGCGCTGTCGTTGCCGTGAAGCGCGTGCGTACGGCGCAGATCACTGAAAACGGACGCAAGCAAGCAGACAACGAGGTGATCCTGCTCAAG
TCGCTGTACCACGTGAACATTGTGCGCTTTTACGACCATTTTCTCGTCGACGATGAGCTCAATATCGTCATGGAGTACTCGGATGGCGGCAACTTGCGTC
AGCTTGTGAAGATGCG