Description :
From Genome Similarity Track
Location :
Scaffold_72:25290- 29317
Transcript NameFunction/comments
Aphas_H257_15418Hypothetical protein

Sequence
4027 bases(100 bases per row)
TCGTCGAGATGAACGAAGGCGTAAATGACCAGCGTAAGGACATCCTATCTGAACGTTTGCTGACCGTTGAAGGGCAGTTGCGTCCTTCATCACGGCCCTC
GTCCAGAAGGAGCTGGATGTGCTGTTCAAGTCCCGCGACGAAAACATCGAGCGGTTGAACCAGCAAGTGAGGGCGTTGATCAAAGACGTCGAGCGCATTA
CGATGGAGCTGGAGTCTAGAAGTTCGTGGAATCGAAGCTTGGCCAAATGCGAAGTCAAGTCCGATGCATCCCCGTCCAAAAAGTGCAAATTGTGTACTAC
ATTCTCTGTGTCGCGTAACTATTACATAGGAGAATCGCTCAAAAGTCCTTCAAGCGATTGCCAGCCATCGATCCGACCGATGACGACGCTACCGTCGCAC
GAAACGAAGACGGCAAGCTCGTATTTGGTACACCTGTCCACGTAGTCACATATATATTGACTTTTGAACGGTGTTAGACAAGAATCTACCTCGTGTGGCC
AACATTGGCAAGAGCAACCAATCGTTCTTGAACACACTGACGCTGCAGTCGCAGAAGCAAAAGATCTACGAGCAGGCGTTCGTGCGGTACGCAGAGTGCA
GGAGCACGGTGTTCGCCCCGAGCAGCTGGGACCCTCGCAACATCTCTGTGCAGCAACTGGAGCTCCCCAACATGCAGCTCAAGCTGTCGCGGGTGCACGG
GTACCACAGCACCGCCAACTCGAACGTGTTCTACTTGGCAAGTGGCGAGCTCGTGTGGTTCACGGCCAAAGTTGTCGTCATGTACTCCCAGGCAAGGCAG
AACCAGCGATTCTACCTCGGCCATACAAAAGAAGTCACGGCCATGGCTCTGCATCCGAACATGGCCGTGGTGGCGTCTGGTCAGTGCGGAAGAGACGCGG
CGGTTATAAATGTATGGGACAGCACGCGCGCCAAGACAGAGCCGACCCACGCCCTGGCCAAGCTGGAAGGCCACTCGGTGAACATTCGGAGCGTGAGTTT
CTCGCATGATGGCAAGTTGATCGCGTCGTTGGGCGGAGACCTGTACAACACCATTTGTGTGCACGACTGGCAGGACCGGACCCTGCTGGTCAAAGCCAGG
TTCAAATAAGACGTGCTATCGAATATCGAATTTACTAAGGATGATGTTGCTGCTGTAGAGGCCACAGCTCCAAGGTGTGGACGGTGGCCTTCAATCCATT
TCAGGCGTATGGCATGCCAGACAAGGTCAAGGCACAGCCGCGACTGTCCAAGAGGCAAAAGTGGGAGACTCGGCCCCAGCCCGGCCAAGCCCTGCGTGAC
GAAGACGCGTGCTACACACTTGTACAAGCTTATAACTAGTTCAGGGGGTGGTCGTCACGATGTTGTAGGTCAGCTGTGGCGTGCAACACATCAAGTTCTG
GACGCTGACCCAAGTGGAGTACTCGCCTCCGAGCACCGTTGCCAAGGTTCATTACGTATCAGTAGTATCTAATCTAAACAACAAATGACTGAGTAATAGG
AAGAGAGCGCGTTCTATGGATCGTGCTTTGGAGGTCCAAATCGAATGCGGCAGCCCACTCCGCATGAAAAAGTGTGGAAACTCGAGGGCAACCCTCCGCT
GATGAAAAGCGAAGCCCAAGACTTTACCTGCTTGGCGTTCACCAACGACAACATCCCGCTCCAAGTGTACGACGAAGCCACGGACTCCGTCGCAGATTCC
CCCACCGTACGACATCTCCATATATGCATTGCTGTAAATCTCATATGACTTATAGCAAGGCGACACGACCCTCGGCCGCATTGTGGCAGGTACTGCCAAG
GGCGATCTGTATGTGTTTTGGCAGCCCCGCAAGTCTCCAACTTTGGACGTGCGTCAGTCGTGGTGGGAGCTCCCGGCGGCGTCGTGGCAGTTGGGGGACG
ACATTTGCATCGAAAACGTCCAGTTTGAGTCCACGGCCAAGCTCGTAGAAATCATCCCCCACGACGTATCGACTGGCAACCGGTTCAAGATCTCTCGCCA
CGCCCAAATGGAGCTGCAAGACATTCACCAACGGTGGCCTATCTTGAATGATGGGGGATATTGGAATGATATTGGACTGTTAGACTGACGTTGAAGCCAG
ATGCCAAGCCTCTGCTGGACCGCCTCGCCAGTCTCGAGTACAAGGGCCCGCTGGCCCACGTGACTGGCCCGTGCAGCCAGGTGGCGTGCGACGCCAAGAC
GGGGAGCATCGCGTCGGCCGGTGCCGATGGAAACATTCATATTTGGAGCCTCCACTTGCTCGATCCGATGAAGGTGTGTGGCACTCGTACGCTGGGCCTG
TACACGCCACTGCACGGGACTGCGAGCGACGGGCGACACAAGCTGCAGCTAGAGCAGAGTCTTCAGATCCCCAGCAAGGCGCGGCTGACGAGTCTGCAAT
GGAGTGGGGACAGACGGCTCGTGGCGGGGCTAAGTAACCACAGCATTTGGGAGGCGGACGTCGCTTCGGGCGAGTGGAGTGTCGTGGTGGAAGGCTGCGA
GGGCAGCGTGTTGGGTATGTCCTATATCGCTCAATATACAAATCTATATTTGGGTTTTGAATAGGTGGCGTCCTCATGGAGGCCCAGAACGAGCTCGTGA
CAGTGTCGAGCGACCACCTCGTCCGGTGTTGGGACCTCGCGACCCTCACGTGTGTCCAGAAGTGGACTCTTAAACCCACAGGCGTATGCATTGAAGCCCA
CCCCGGTCGCCGCGAATTGGTGGTCGGGTGTGCTGGAGGCGAGGTACTAGCCCATATTGAAAGGAAAAGATGAGATGATTCTGGTTTGTAGCTGGTGCTG
TTAAACTACCCTGAGCTGTCGGAGAAGAAGACGTGGCGCGTGCTGTCGAACGAGGGCGTGAGTGTGTTAAAGTACAGTCCCGACGGCAAGTACTTGGCCG
TGGGAGCCAAGGACAACTGCATGCACGTGTTCGACGACAGCTACAAGAAGGTTTCCAAGTGCGAAGGCCATGCCACGTATGTGTCGCATATTGACTGGAG
CGTGGACGGGCACCTCATGCAGACCAACTCTGCGGACGGAGAGATCTTGTACTGGCAGGTCCACGGCGCGTCCGTGCGGCAGATCACCGACAGCGTCGTC
GTGCGTCGTCCTACCATTTCCTCCACCTTGTTTGACTCATGGGAATGTGTGTAGATGCGGGACATTCTGTGGGACCGGTGGAGTTGTGTGTTTGGGTGGC
CGGTGCAGGGAATATGGGCAGACGACAGCGCGTGCAGCGACGTGTCGGCCGTGACGCTGCTGGACGTCGCGCCCAAGTACAAACACCGGCCGGCGGATGT
GCACAATGTGCTCGTGGCTGACCGTAGCGACTTGCGCTGCTTTCGCTGGCCGTGCATGAAGTCCGCCCAGAGCTATACCTACCACGGCCATGCAGCCAAT
ATCACGTGCATCTTGACGTGGAAGGAGCATAGCATCGTCACCTTGGGCGGCAGCGACGGAACTATCATGGAGGTACTATCCCGAGCGATTATTCGGTAGT
ACTAATCGTACTGTGAAGTGGACGGCTGTGGCGAATGAAGGAGGCCCCACAGACGAAAGGAGAGATCGAATTGAAGGGGACAATACAACACCTGTGTACG
ACGTGGAGGTACCAGTGGACCCGCCCACAAGTCCTACCCCGCCGCCCAAGTCTGCCGACAGCAACCACCGACCTAGAACCCCACGCCAGACATTCTTCAA
GGAAGAAGTTCGTGAGGACGACTTGACTCTTCGCGAGGAGACCATTGCACCTGACAACTTCACCCGCATCTCGGAGATGGATAACTTACACATGTCGCGT
GATGATGAACCACCCGCAAAGGAAGAAGCGATTCGAGAAGGAAGCACAACGGATGGCATCGAGTGCGGTCGTGCGAAGTTTGCGTTCCAGGGCGAAAACC
CCGACGAGCTCAACCTGAAGGAAGGCGAAGTGATTCGCATCTTAGAGAAGCGCCAAGGCGACTGGTGGTTCGGTGAGACCTGCGATGGCACTCGTGGCAT
ATTCCCGAGGGAGTACGTCGAGATCGA