Description :
From Genome Similarity Track
Location :
Scaffold_784:2529- 5443
Sequence
2914 bases(100 bases per row)
GAGGAAGACTCCCTGCTGTTATGGTTCGTCGAACTAGACAGAGCCATAAAGGCACGTCGTATCGATGATGAGCAAATGAAACTCACATTTGCTCAAACCC
AATTGGCGGGACGTGCCAAGACTTGGGCCTTAGGGCTGGAGATGAGCGACTGATATGCTTTTGGGTCACTAGAAGCTTTTGAAAATTGACTCAAACAGAC
GTTTGAGCCGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCTGAAACTCAAACAGGTAAGCGTGATGTGTACGCTTACGCTCAACATATACGACTCC
TCTCGAAGAGTAAAGTTGCTAACCCTGTACATGAACACACGTTGATTACTGTGTTTATGCAAGGGCTCGTGGATGGGCCCGTCAGAAACCACCTGTTCCG
CTTAGAGTTGGATATGCTTGAGCAAGCTATCTCAGCTGCGGAACAGGAGGACTTTAGCATGAGACAGGCTGATGCTAGCTCGAGTTCTTATCGTCCATCG
AGACGACAAGAGACTGGAGGTCCAGAACCCATGGACCTCTGTTATGTCGAGAGCGAGAGACCTCGCTCTTCGAATGACAAGCGATTGCAGAAGTGCAATC
GCTGCCAGAAGTTGGGACACTACGCCTACGAGTGTAGTGCCCCACGCCCAGTACCAAGCAGTACAGAGCGAAATGATTGGCCATTTGCGAGAAAGGACAA
TGGGCGCAGGTCTAACGCTGTTGCGAAACCGCAACAGCGAGGTGGAACATCAAAAAATGGTCGGGGTCAGTAGGGGCGGAGCACCCTACTGATCCAGCAA
CCTCAAGAGAATTTGCAAATCTCTTGACAAAAGTTGCTCCAGATACACAATCATTGTGTGTCTCTGCACGTGTTGATGAGGTATCACTCATTACCTTGGA
ACTGAAGTGACAAATGGTTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAAAAACTTTGTCCGTCGTCAGTCGCTAGAGAGTCGTAGGCTCAAGT
TCGTTGAGCGCGACATCCCCTAAACGATGATGACGGTGTGCCTTGCCACACGCGCGTCGATAACCGTTGAGAAACGTGTAGTTGGAATCCACTACACAGT
ACGATGATGATTTCATCGTACTGGATCTGGATGACAAATTTGATATCATCCTGGTATCACCTTGGCTCAGAAGATACGGGCCAAGTGTGAGCTGGCAGCA
TCGATCCGTGAAGATGCCTGCCGCTTATTCATCAGATGGTCATCTAATGAACGTCATGGAGCGTCCACAAGCGTGTGGATGTACTGCAAGTGAGTGTGAT
GGCCTCACTTGCGGTACGGTCGTTATTACGACTGCACAGGATCACAGTGTGACAACCAATCACACTTTGGAGGAAGCTGCCGGCGGCTGTGCGGATGCAC
AGGCAGCGCCGAAGGTCCACGACTCGAATAAGTCGAGTGGACCGGGACATGGATGCAAGGCTAGCGGGCAACATCCTAGGAAGATGAAACCGGTTGCCAC
CAAAGGGCAACACGGTCATCCAAGGTCGACTGGAGAGTCACCTGTAGAGGATCGGTACCTGACTATGGTTGCACAGCCACAGTCAGACGACGCCGAGGTA
ATAATTCCCCACGTACTTGAGAGAAGGATTTCTCAAGAGTCACATACTGAGAGAAAAGGCTCTCAGCAACCTGAGGAAACAAGTTCCCAGGAAGTAACCG
AGACATTGAATGTCTTGGTCAATGACGGATCAAACGTAGGCGCTTATACGCTTGATCTGAATGTGCCTCCGAAGTTAACTTCGGAGATAACTCAATTGCC
AACGCTGGAACCGAAACGGTTCCTGCGTGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGCATACTCTTCACAGAGGATGAGTATATGACCGATATTCGG
TCGGCAACAGTATTTGCTGAGAACGAACGGGTTCTCAGCAGCTCATCGATGGACGAAATTGTCTTCGATGAGAAGACTCGAATTGAACGATACACGTCTC
AATCTTTGGAGTCGCTTCAGGCAAATCCTTTGTATAAGAATTTAATCGAATTTAAGGATGTATTCCCTGAATCCGTGCCATGCGAGTTACCTAAGGACAA
AGGCACTCGACATGAAAATGAGCTTGAACATGGCTCCAAGTACTGAGTCATGAAGCAGTGGCCGCTGCCTCGTGAACAAGTACTAACGATCGACAAATTC
TTTACCGATCGTTTTGCAGCAGTCCATGTGAGGGATTTAACTTTTCTTCACAGCTCCTTGACCTTCTGTGTGCGAAAGGCCACAGGAGGATGGCGGATAG
TGCACGCATTCAACAAGCTGAATGCTGCAACGATACCGGCTCAGACACCGAAACCGAGGAAGGACGTAATCATAGATGGTATGTCAAAAAGTACCATCTT
TTCGTCCATGGATCTGACGGATGGCTTCTATCGAATCCTAATGCGTGAACGGGACATCCCGTACACAGCAGTGAGCACCCCTAGCGGTATGCTGTGGGAG
TGGCTAGTGATGCCACAGGGGCTAAGTAACGCCCCAGCAACGTTCAACAGATGTTTAACAAATCTTTTGAGACCGGTGCGGGGTTTCGCACCGAATTACT
TTGACGATGTGTTTGTCCATAGCCGGGCTATGGATGGGAAGACGGAAGTGGAAGTTCATAGAACACACGTTCGTCAGGTTCTTCAACTTATACGAAAGCA
TAAGTTGTATGCAAACCTCAAGAAGTGTATATTCCCTGCTAGCGAAATACCACTTCTTGGGTACATCGTGGGTAAACAAGGCGTACGCCCTGATCCTGAA
AAGATCAAGGCGATCACCGACTGGCCTGTTCCAGTCGATGTCAAGGGACTAAGAAAGTTCCTTGGGCTAGCGGCGTACTTGCACAAGTACTCGCGTAACT
ACGCCGAGATGACT