Description :
From Genome Similarity Track
Location :
Scaffold_25:252892- 261028
Sequence
8136 bases(100 bases per row)
ATTGGGGAACGAAGCCGACCGACGAAAGATCGTTCCATGGTCACGAAGGAGACCCGAGACTCAGTGGAAACGTGGGGTTTGACCAAGAACGATACCCGAG
ATATGCGATGCCTCACCCAACTGCTCCCATGGCCCAACATGCGGGACGTGCGCCGCATGACTATGGCCGAGGGCTCGCTCCGATGGTGGAAATCCCAAAC
GAATTGAGGAACGCAGTCAAAGTGATCGTTCCGCTTTATTCGGACACGGCCTCGAGTGAACGAGCTGCGGCGTTTTGGCGTTCGTTCGAGAAGTGCACGA
TGGGCATGGACGACCAGCTGCGCTTGACGGCTTTCGAACAGTGCCTGAAAGGAAAAAAGGGACAAGAATGGTGGTACAACTCGAGGATCCATAACTTTGA
ATCGCTTCGCTCCCGATTTCAAAACCGGTTCGTTTGCCTGACTCCGGCCCAAACCTGGACCCGCCTGAAGACGGCTGCTAGGAAACGAGGTGAGTCGGCC
GAAGAATGGGGCGATCGACTTGAGACGATATGCGACGCGCTGAATTTACCCGAACCCCGCATGAGGTACGAGCTCTTCCTTGAAGGAATAAGGAACAAGC
AGATGCGAGCGGTGCTGAACGGTAACATGATTGGGTCTATTGAGCAAGCCTGTCGTATTCTGTTGTTCAAGAAGCTTCACCTGCCTATCGAAGAAGACGA
TGAGTTTCCAGAGGATGGAATGAAACCTCTGGGCACGAAGAATGTACCCTCGACGGAGTTACAGGTGCTTCAAGAGCTGCAACAGCTAAATCGGAACGTG
CAAAAACATTCTGGAACGAGCGAGGGGTACATAGGCGCAGTGGCTTCGAACGATCCGAAACCGACTAGTCCTTCCAATGGCGGAGTGAGTGCTGAACTGA
GGCCTCCCAACATTCATATGGGCCCCGATACTCGTACCGCAGAAGGAGAAGTGGTGTGCGGACGCTGCGAACGAAAAGGGTGTGGTCGAGAGACGTCCCC
TCGTGCGAGGGGCCTGTGTAATCGCTGTCATCAATTTGGTCACTACTCCATGGAGTGTAGGTGGCCTTGGAGAACGAGTGGAAATCGATTTGGAGATCGT
CGGACTGCGGAGTGTTTCTTCTGTCGACAGCCGGGTCATGGTGTGACCAACTGTCCCGAGATCGAGAAACTACGTAGTCTCTCGAGGAATGCCGAAGCAA
GTGGAACGACGACTGCTCTAGGTTCGGCTACACCGACTGGAATGTCCCGACAATGAAGGGGGCAAGAGGGAGGGGAAAGAAGTGTCACTCTTTCCTCTTG
CCAGGTTGGCGACACAAAAGGAGATGAAGGTTCACAGCTAAGTGGATTTGGTGGACCTGAGAGGGCTCCCGAGGTTGGTGTGAATACTGGAGTAAACGCT
CGGAACGTTCCCGTTGCGAGCGTGACGATTGAAAATGCAGATGTTGTGATTGGAGCGAGCAGTCTAACGGAACAGACTGGCTCTAGGTACGAAGGAGAAG
AGGAAGTCTCTACGAAGGGACCGGAAGTAGAAGAAGAACGAGAAGGAGGAGCAACGGAAAGCTCCTCAATGACGAGGAAGCGTGAAAGTGGAACGAAGGA
TCGTTCCAATTGGGCACAGGACGTCGATCAAGGGACAACGGAACGTCCCGAGCACCTCCTTCAACCGATTTAGGGCAACGACATCTGGGACGGGTCCGTC
TATTTTAGAAGCTTTTGGTTTGTCGCGCAATTTGTCACGGATGGTAGAAGCCTCTGTCCGGAAATAGGAACGAGCCCAGGTCACCGCTCGATTTAGGAAC
GAAGGAGTCGTCGTTTCACCTACTTTCGCTAGTTGGTCTCGGAGAGACTCCTCGTCCAACACGTTTCCTTCGGTCTTGTCTCGCAGCGGGGGGACATCAG
TCCTTATTTCGCTTCCTTCCGCCGGATCAGTTTCACTCCTCCCACTTTTGCCGTATTCGTCTCTTTCCAGTGTGAGCATGTCATACACTCTCTTACGAAT
TTCGGAACGCCACCTACAAGGTAACGGCACTCCTTCTTCGGCTCCGTCTTTTACAGTAGGGGACTCGTCAAATCCGACGCAGACGTTCCGTATAAACTCA
CTGTCAGCGGAGTCGTCCTCCGAAGCACTGTCACCGTTTTCTTATTGGGTGATAGCGCCGACGGGTGACGCAGTCTCCGTCGTTCCCGTTTCGTCCTTAA
AGTTTCGATTAGCACGCCTGGCCGCTGCAGAATTCTCCAGTGTCCTCTCGTACCAATCTAGCCAGTACTCTGGCTCCCTCAATTCTCCCGTAGAGACTTC
CCGTGTGCGCTCTAGCACTTCTTCCGATATTCCCAGCTGCTCACTCAGTTCTGCAAGTGACGGCTTTTCTTGCTTGCTAGCGTTCTGTGTTACTCGTGAC
TGAATCTTCTCGTCGTCCAACGGAAACAGTCGCTCTTCCAGCTCCTTGTCGTACTCCTCGGGTTCACTCTTCACTATCGGATCGTCACCGCGCTCGAGCA
TATCAAGCTCCTCGTCGGTAAACAGACGATCATAGTCGTTTGATGAGTCCGTCGCCTTGGTACGTTCCGTATTTAGTTCAGCTTCATGAACTTTAACGCT
CTCCTCAGGAGCATCCACTACTCCGATCACGGCCGCAAATAGGTTAGTTCTGACGCCTACCACGTCTTCCGTCTTTGTCTCGAAGTGCCTGCTCAGCCCC
GTGTATACCTTGTCGGGACAACTCGTCCGCTTCCGCTTTTTCCGTCGCACTCTTCCTGGGTCTTCAACGCATCACGTTTGGACTTCCAATCCAAGCGCTG
GACCAGGAGAGGCTGAAAAAAGCCGATGAACAATCCGACATCTATGCCATCTACGCGCGAAGGGCTCCGCGGCCGCGAAGGTCGCCGGGATTGCGAGCAG
TGAGTGAGGACGATGCCTCTCAGGAAGGGGCAGGAGTTGTGCCGGAAGGAAAGCGCGTCATTTGTAGTGTGGGAGGGCTGAAGGCTGTAACCGGTGGCTT
CATCGACTGTTGCCCTTCTGAGATGTTGGCTGACACGGGCGCTGTGGCGAGTCTCGTGAACAGGCGAGTGCTGAAACGGCTTGGTCGAGCGTCAGAACCC
CTCAAGCCCTACACTGGAAGCCTAGACAGCGTTTCGGGACATGAAATACGAGTACGTGGCGTGTTCGAACTCCCAATAACACTTGGAACGATCGATAGGA
CTCTTCCGTTTGTGGTAGTCGACCATTTGTTCGTGGATGCCATTTTGGGAACGGACTCGTTGCGCTCGTTCCGAGCCGTAATGGATCTCGAAGACCAAAC
GATGACACTGAAAGGAACGGGAGATGTGATCCCGTTGGGGATCTCGAGAGTGGAGGAGACTTATGCAGTCACGACGACTTCAGCAGTTCGCTTGAAGCCG
GGTCACTTAGCGCTGGTCAAGTCTAAAATTCGTGGAACGATGAAAGATCGCTCCACAGTTCTGGTAGAAGGCATTCCAGGGACCGATGAGAACCTGAGAG
TGGCCCGGACTCTGTGCACCGTGAGGAATGGGATGGCCTTAGTGGAAGTCTGTAACGCGTCCACAGAAGAAGTTGAAATTCCGTCGGGTGCATACGTGGC
AACTGTAACTCTCGTTCCTCAATCTGCTTTTGGAACAAAGGTTCGAAGTGGAACGACGAATGAAGTAAGCGCAGCGATAAGTGCCGCTGGCAACAACGAA
GAAACGGGAGTGGGACCCGCTGACTTTGAAATAGCCACCGCAATGCAGAACGAAGAAGACGACGATTTTGAAGTGGATTTCCAAGGTTCGTCGCTGGGAG
CGGAACAGAGAAGGCTATTTGCCGAGATGCTAGGTGGTCTGAAGGATTTATTCGTAGAGACGTCCAAGAAATCGGGGCGTACGGACCTTTCGAAGTTCAG
CATCGATACGGGAACGAGCGTGCCGATCAAGCAGCCGCCCTATCGAGTCTCGAAGTTAAGGTGACGGTGTTGAAGATGTCACCGCACCACTTGATGAAGA
ACGAGGTCCTTATGCGTCTCGTGCACTTAGGGGCTCGTGCTGGTCCTGCGCGGACAGTGACAGTTCCTGTCGTTCCTTTACCGTTTATCGAGACGGCTCT
ACATTATGGTCACGCTGACATATTCTCTGCTCATTTGGGGAAAGACGAAGACATTGGACAAAGTGAGGCGCCATGCCTACTGGCACGGATGGCGAAAGGA
CGTGGTCGAATATGTGAAAGAATGTGCCCTTTGTAGTGGTGGCAAGGGTCGAAAACCCAGGAGAGCCGGTCTAATGCAGAAGATGCCGATCCAGGAGTTA
TCGGGACCGTTCTCGTTGTTGGTGGTTGACGCCGTCGGTCCTTTAGTGGTCACTCCACGAGGGAACAAGTATATTTTGGTGTTCGTGGATTATTTCACGA
GATGGGCTGAAGCTTTCGCGGTGGCGTCGTTGGACACGATCACGTTTGTGGACGCTATGCTCGAAGGTATCATTTGCCGTCACGGCGTTCCGGAACGACT
GCTTAGTGACCGAGGAACGAACTTCACATCCGATTTGGCACGATCATTATACCAGACGCTAGGGATAAAGAAGTTGTTTGGAGCCGCCTACCACCCCCAA
ACTCAGGGACTGGTAGAGCGATTCAATGGGACGCTGCTGGGAATGCTTAAAATGTTCGTGAGTGAAACGCAGACCGATTGGGATACCTATTTGCCTCAAG
TCCTATTGGCTTATCGGACTGCCTATCATGAAGGTCTTGGAGATACTCCCTTTTTCGGTCTGTATGGTCGTGACCCAATATTGCCGATCGACTTGGCCTT
CCTCAACACCGGAAAGGACTGGAAGAGCAACGAGATTGCCACATACCGAAGGAAGGTGTATCTGTCGTTACGTGACTCAAGGCGCCTGGTGGAACGACAA
CTATTGAAGGCCCAAGATCGTCACGAGCAGCGATTGAATAAGCAAGTCAAGGTCACGTACGAAGTAGGCGATCCCGTCTGGGTCTATCAGGTCTTCAGGG
CCAAAGTTGGCGAAAACAAGACGAAGAAGTTGGCATTCTCTTGGCACGGTCCGTACCGTATTGTCGGCCAAGTCGGGGAGAATGCGTACAAGATCGCAAT
CCCTAAACACCCCGACCGGGTCGTTGCTGTGAACGTGAATAGGTTGAAACGCTTCCGTGGTCGCTGGAGTCGACCGTTCGCGGACGAAGTGCCTAGAAGA
ATAGCCGAGAATGTGGCTCGTGGGAGTGATACCGGCGAAAATGTGGCCGCTGGGAACGAGACGAATGATGATGCAGTCATCGAGGATGATGACGAGAACG
AATTGCTATTGGAGGCGGGACCACTACAAGAGGAAGATCTGCCCCAGTCAAGTTTTGTAGAACGAGTGTCGATCGGGGGTGAAGAAACAGCTTTCACGGG
CGTCTCGTCGCCCATTGTGGACGTCGTTGCTAAGAGGGTGGATAAGGGTGAGCTGCAGTACCTAGTACTGACGGCCACGTACGAGACCTTTTGGTTACCT
CGAACCGCTCTGTTCCCCGAGTTCGGAACTATGATAAGCGTCTTTGAGGAAGCAGACCGCAAGAAGAAGGGTCTCCCGGAGATACGTCGGAGTGTCAGGT
TGGTCGAAGCCAACGCTGATGTGGACGACGCGGAAGTGTTGTTCTAACTGGTCCTTTGACTGGTTGGAACGAGTAAAGCTGGACCGCTTCACTCTTGTTG
GTGTTTGAGAACGAGTGAGTCTCGAAACACTGGACTGTATTTTGCATTTCCATATTGGAACGCTACGAAAAGAGACACTGGGAAAGTGATATGGGGTATC
GACGGAGCACAAGACCCTTCGGCGTGATGGTTATGCCCGGGATTGACAAAGTTGGAACAAGGAAAGGTTGTCACGAGAGGCGATGTCGACTAACTGGACA
TCGAGGAGCGGTAAAGACTTGTAAAGCGGGGACTAAACGGATATATTCGAGACGAAGAAACAAGAAACGGAACGAGGGATGGAAACGAATCCGAATGAGA
ATCTACTTCTTGGTGGTCTTCCCCTTGTCGGCTGAAACCTTCTTGGGAACGACCTTCTCACCGTCTTCCCCGTCGTCGGCCTCAGCGTTATCCTCCTCGT
CATCGTCTTCGTCGTCTTCCCCCGGTTTGTACTCGTCTTCGTCGTCGTCTTCGTCGTCGTTCCCAGCTTCTTCGTCATCGTCCTCTCCGTCGTCAGGGTC
GTCATCGGCACTAGGGGAGTCAGCAGTAGCAGCGGTCACGACCGTGGAAGTTGGAACGGCAGCTTTGGCCTCGTCTTCGTCGTCCTCTTCGAGATCGGAC
CAATCGGCACGTCCGGATTCCGTCGTGGTCGGTCCCTAAACTTCGGGGAGCTGGTACGAGCCACTCTCCAACTCGGTTGCGACAGTCGGTTGGGTTTGCT
TCACCAGGGCGTTGTCCATAAGGGTCTTCCAAGACTCGTCACTAGTGGATCCCACCAAGGTGTCACGAGGCGTCGCGGAGGACTGAAGATCGAGCCGAAT
GCGTGCCAAAGCCACCATGGAGAGTCGATTGGCCGGCTTTACCGTAGGGACCAAGGCCTCGGTCGTCTCTACAGGACGCGGATACTCGGGTACCCGTACG
CGTCGATCTGCACGGGCTCCAGAGCGTTGTCGATGGTAGCCTGATATCGACCCGGATCCTTGTCTTCGAGCGAAGTTAACGTGTCCGCGAGAGGTCCGTC
GTAGTGCAGGCACTTCTTGTTGTCACGACCGGGTTGGCCTTCCATCCAGAACATTAGCGGGCACTTGTCGAGTAGCGTGGAACCCGTAAAAGCCCCAAGT
TTCGATACACAAACTAATGAAGGCCACTCGAGCCTGTACGGCACGCTTCTTGGCCTTGCGACGATTGTTCTGCGCCGTCTCCGACGCCAAGGGCGCGTAC
AAGGCCCATTCCCAGAACGCTCGACGGTGACACATCCAGAAGCGCCAGTGACCCCGATAGATCGCGCGGAAACGAAGCGGGTTGTACCACTGCGGACGCC
CCGTCCAAGGATAAGCGAGACACCAAGGCTTCTTTCCGGTCGCCCCCGCCTTGGCCAAGATGAAATAGACGACAGCCTTTACTGAGTCAGGGGCGTCGAG
GTTCAAGTCGACCAGCGCCTTGTACTCGGCCGAAGGAACGAGCGAAGAAGTCGGCTTGTCTGGCTTGTCACTGCTCCGCAGCTTCTTAGACGACTTGATT
GGGGGTGGCCCGTTGCGAGTTTTCCGCTTGCCGCGTACAGGCTTCTTTGCCGACGAAGTGGAGGAGGAGGTAGAGGATTTAGCTGGCGTGGACGGCTCGG
GTGAGACTCCTGACGTTGACGGCATAGCAACCACGGGACCGCGCAATGCGATGGAGGGTCGACCTTCCAGGAGATCGTCGACCAACCGCTCCATGTGCTC
CAGACCAGTGGAAAGGCCGTTGCCGCCCAAGTGCGCCTTCAACGCGTCCCAGAACTCCCGCTTGATGGTCTTAGCGTCGTCCCCTGGCGTTCCATGCTCG
TCGTACTCTAGGGCCGCGTCGAAGAATCGCTTGAATCGCCGGCGCTCCGCGACAGTGAGGCGCTTGGACATGCTGACTGCTGAAAAGTTGTAGCTGGGAG
GTGTTCTACGTGGAGATTGTTGGAAACTGAAAGATACGTCGCATTTGCTCGAATGATGGCTGACGGACGTTGGAAATAGGTCGCCCGCGACAGGGTGCAA
AAATGGAACGAGATGAAAGAAAACGACTTGGGTGACACTGACGCCACTTGGGAAGGGGTGTCAACGGACGACGCCAGGATGACCTTTCCTGACTGACGCA
ACGCCAGTTTTAAATGATGGAAGTGCTGAGAAGCTGGGTCGATGGAATCGAAGCAGTGGCTCCCGTCGTGACGTTCCCGGAAATCGAAACAGGAGGTATG
GTGGTCTGCGTCGTAGCTGGGATAGTAGTGTGGGTGGTCACGACGCCTTTACGCAATGTGGGATGCGCTTTCAGTGCGAGCCTAGTGGACTGTGGCTCTA
CCGTCTACTTCTTCTGGTATACTTGTAGTGACCGATTTGTCACTACCGTCCGTGGAGCCAACGCTCAAGAGCTGCACCCTAGAGAATATGCGTGCACTTT
GGTCACGCTGATGTTCCTCGTTCCCATGGCGGTGTT