Description :
From Genome Similarity Track
Location :
Scaffold_41:25289- 26494
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_41-snap-gene-0.26Ubiquitin carboxyl-terminal hydrolase

Sequence
1205 bases(100 bases per row)
GGCCGTCGCGACGCGGACTCGTCAACATGGGCAACACGTGCTACATGAACGTCGTGCTGCAGGCGTTTACGCACAATCCGCTGCTGCAGTACTACTTCTT
TCTCGCCAAGGGCCACGGCAGCACCCTGTGCAAGCAAACGCGCAAGCAGCAGACGCCGCCGTCCGTGTGCCTCGGCTGCGAACTTGGCGACTTCATGGTG
ATCATGTCCCCTGCTACTTCCTCAAGTACAAACTCCTCCATGCTTGCATCGTTACCAGCGCCGTCGTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTTCCGCACAAGCTCCTGGAGTCGTTCTGGAGCTTCGCGCCGTCGTTCATTGGCTCGCAACAGCACGACGCGCACGAGTTTT
TTCTCGAGTTTTTGAGAGGACTGCATTCGCACACGCATGCGCGCGTGTCTGTACCCNNNNNNNNNNTCACCACGCTTCACACCAACGGGAAAATCGCTTT
GCGATTGCGCTGTGCACCAGCACTACGCCGGCGTGCTCCAATCCCAAGTCGAGTGCGTCGTGTGCGACCAGGTGTCGTCAACGTTTGACCCATTCTTGGA
CGTGTCGCTGTCGCTGGAGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGCCACTCACGCTGACAGATCTGC
TCGCCAAGTTTACAGCTGACGAACAGTTGCGAGGCATCAACCGCGTGTACTGCCGTCGCTGCAACGCGTACGCCAACATGCTCAAGCGCTTGCGCTTCCA
CGCACTCCCGAATGTTCTCGTGCTCCATATCAAGCGCCTCGACTTCCACAAGCAGCGAAAGCTGTCGAGATATGTGCAGTTCCCAGCGACAAAATTGGAT
TTGGAAGAATTCCGATCGGAGTCAGGGGATTCATGCGACCAGGACCCTGTGACGCCGCGAGCGAAGACTCAAAATGGAAATAAAGACGCCGCAGACGCCA
GTTTATACGACCTGGCGGCGGTGATCAACCATCACGGAGACTCGGTCGAGGGCGGACACTACACGGCATTCGTTCAGACTCGAAACGAGAATGACTGCGG
CAATGACAGGAGGAAAGAGTCCAAGCCTCAGTGGCTTCTTTTCGACGACACGGACGTGTCTCGAGTGCGAGAAGAGCAAGTGCTGAGCAGCCAAGCGTAC
GTACT