Description :
From Genome Similarity Track
Location :
Scaffold_285:25285- 28167
Transcript NameFunction/comments
Hyaar_Emoy2813509predicted protein

Sequence
2882 bases(100 bases per row)
TGCGCCTGGAATGATTCAGATGGACGAGGTGTCGATAGCTCAAAAGCGAGAAGAACTAAAGCGACGACTGATTCAGCTAAAGCACGCGCGAACGTGCACC
ACGGGTGAATGTGGAATCGATCACTGCAGCCGCACGAAGGCGTTGCTTTCACATGTGTCTCGCTGCGCAGACGCTCAGTGCGTAACGCTGGGGTGTAAGT
CGACTCGACAATTACTATCGCACTTTCGTAAATGCCGCAATCTACAGTGCGACGTGTGTAGCGCTATCCGGCCTCCGATGAACGAGAATGAACAGCAACT
GGTATTGCGACGTCAACAAGAGCGGCTTTGCATGCTACGCCATGCTAGTACTTGCACAATGGAGAATTGTGTTTTGCCGTATTGCGCTGGGATGAAAGTG
CTCTGGAAGCACATCTGTGAATGCCACCAGCGTCAGTGTCGAACGGACCATTGCATTTCGTCGCGTTACGTACTATCTCATTTCAAGCAGTGCAACAAGA
TGATCTGTGAAGTATGCGGTCCTGTGCGAAAAGCTATCAAAGTAGTGGACTCTTGTCGAGGGAACCCTACCCAGCTTCAGTTGTCGGCAAGCCAGTGTCC
GGACGGTGTACGCGGATTGATCAAAATTATGAACACCACCATTGCAGCAAATGCTTCAGAGACCTCAGCTGTTGCTGCACAGGCTGGAGTCGGAAACGAT
GTGACAGGCGGTTCCCAACTAGCAAGCGCGAAGGCAAAGGGGACACCTGTGGCTAGTACTATCGCTTGTGGTGCGGCTAGTCCGTGCCGCATTACTACTG
CTAGCGAAGCTAAATTAACAAAGATGAAAGAAGCGAGTCTGGCGGAGGACACGAAGAAGAAACCATTGAAGCTTCAGACCGAAAAAGAGAAAAAACTTCG
CCGGAAAGAGCAAGCTAAAGTCGCGAAGGCTCGTGCCCAGGCAAAGGCAGCCGCGGCGGCAGCGGCAGCACTTACTGGACCTATTGCTGCTTTGACAGCG
GCAGAGGCTGCACAGCCTGCGGTGCATAATGGTCTCGTCGTTCGTGGCACTCAGGCGGAGCTACGCGACGACCACCATATTTCGCATCAAGACATATCTT
TCCTGGATTCGATGACAGAAGGCCAGCTAGATGAGCACATCCGTTCGCTTCGGTTCAATTTCTGTGGACACATCTCGATCAGTGAGCTAAAGAGTCGACT
GATGCCGTTGCTTACTAAGCTTATGGAAAGTGATTATGGTTGGACATTCAACAATCCGGTGGATCCTGTGCAGTGGAACATCCCTGACTACTTTGACATA
ATCAAGTGCCCGATGGATCTTGGCACGATCAAAAAGAGGTTGGAAAGTGAGCACTACAGCAGTGTTGAGTCGTTTGCAGGTGACGTGCGTTTGGTGTTCG
AGAATTGCATTGCATACAACAGCAGTACGAACAAATTTAATATTGCAGCAAAGCAGTTGCTTGCTTCATTCAATAAGGCATTGGCGGCGCTCAAAAATGT
GTTGGAAAAGCAGCTATTTAAACGCTGTGAACAGCGTCGCGAAGAGATGTGTCAATTGTGTGGAGGCGACTCGTTTAAGTTCGCGCCGTGCATGCTTTTC
TGCAGCGGCCCTTGTGCTGGCCGGATACGAAGACATACTCACTACTACAGCGATCCTCGAGGAGAGCACCATTGGTGCTCAAGTTGCTACAAGCAGATGA
AAGACGGCCCGATCGACATGTCGCTTGTGCCTCAATTGTCAAGTGCCACAACTGAAGTAGCTCCCCCTCCTGGCGCTGACCTCGTTCCTTTCGATGGTGT
ACTAAAGAAAGTGTCGTTGGTAAAGAGGAAAAACAGTGAGGTTGCAGAAGAGCCATGGGTGGAATGTGACTCGTGCAAGTTGTGGTATCATCAGATCTGC
GCTTTGTTTAATGAACGGAACCACGCAATCTCAGGTGAGCAAGAACCGTTCGTGTGTCCAATTTGTGTAAAGAAACAACGCGTTGCTGGAGTGAAGCCGT
CACTACTCAATGGTCTTAAGGCCAAACGCCTTCCAATTACACGAATGGCAAAGCTGATTGAGACTCGCGTGCTGGATTCCATTGAAAAGGCGGGCAAGGA
CGAAGCAGCACGTTTGGGTAACATGGGCAACTCTGACAGTATCGGCTTTTCTAGTGGCGCCAAAGAATCTGCGTCCGACACGCAATTTGGAGTTACTATT
CGCGAGGTTCTCAGCATTGATAAGCAAGTGCAGGTCAAACCAAGGATGGCTAAGTTACTAGCATCGAAGTATGGGAAAACCATGAAGACCGATCACGGTG
CTGGGGTTGCGGCTGGGCAGACGAAGTCGCTAAAACGCCCGCGACCGACAAAATCCATTGCTGGTAAGACTGCTACTGCAGCGGCATCGATGTCTTTGTC
GTTGCAGCTGACGTATCGATCGCGATGCATTTGCGTCTTCCAAGAACTGGATGGCGTGGACGTGCTTATCTTTACACTTTATGTGCAGGAATATGGCCCG
GACTCGCTCTCACCAAATGCTGGGCGAGTGTACGTCTCGTATCTGGACTCGGTAAACTACTTTCAGCCGAAGAAGCTGCGTACGTTGATGCATCAGCAGG
TGATGTTAGGCTTTCTGGAAGACTGCAAAAACCGTGGCTTTCACACGTGCCACATTTGGTCTTGTCCACCGCTAAAGGGCGATGACTACATTTTTTTCTG
CAAGCCGGAAAACCAGAAAATTCCGAAGTCGGCGCGTCTGCGCCAGTGGTACCAAAAATTGCTGGTGCAAGCCAAACGGGATGGGCTCATTGCCAACGTT
TCCAACCTTTATGCTGAGTACTACACAAAGAAAAAAGCAGCTCACGATCTGCCCTACTTTGAAGGTGATTACTGGCCGCGGC