Description :
From Genome Similarity Track
Location :
Scaffold_82:252836- 255209
Transcript NameFunction/comments
Physo_109272pol protein

Sequence
2373 bases(100 bases per row)
GCGTATCGTGCATGCTTTCAACAAGCTGAATGCCGCTACCATTCCTGCGCAGACGCCGATTCCTCGGAAGGATGTGCTTCAGAACAACATGACACGATGT
ACGATGTACAGTGCGCTCGACTTGGTCGATGAATATTACCAATTGCTCATGAGGACGAGCGACAGTCGTCTCACTGCGGTGAGTACTCCAAGCGGCATGC
TCTGGGAGTGGTTGGTGATGCCCCAGGAGAAACGTACTTCGATGACATCTTTGTCCACAGTCTTGCTGTACACGGAAAGACTGATATGGAGAACCATGTG
GAGCACCTGCGTGCTGTGCTTGAATGCATGCGTCAAAACAAGTTGTATGCCAACATTGACAAACGCCTCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGT
GCTACATTGGAAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAATGGCT
TGACTTCGCCAATTACTTGCACAAGTACAGCGAGAACTACGATGAAATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGGAC
ACCGAGCATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCCTTCATGCGTCTATTCTGACTTTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTG
ACGCCTCAGACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACGTCGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGACTGCGGA
GAAGAACTATCCTGGCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTAC
ACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCATTGGCTGTCCTTCTTCGCGGAGTACAACTTCGGGGTGA
ATTACAAGCCTGACAGGTAGAATGTCCTTGCGGACGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTGTTTACCGGA
TTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCGTTGCTGAACGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTATCAGCG
CGGCTGCGCGCGCGGCTACACCGAAATTCCCTCGATGGTGGCGTGTTGTTCTACGACACTGGCCCCGAGGATACGCCCCGTGTGGTCGTCCCTCATGATG
AGGATCTGAAGTACCGCATCCTTTATGAGGCACACGATACGCCGCTGGCCGGTCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTG
GTGGCCGAAGCTGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGAGGTGCCAGCGAGTGAAGTCGTCACCTCATAATGCAGCGCCGTTGGCGAGT
TTGCCTGTTCCTTCGGGCTGTTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGTGGATGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGG
ACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGACACCATCGATGGTAAAGGTACAGCAACGCTGTTCTTTGACAGAGTGTTTCTACAACACGG
ACTCCCTGAGTCGATTATCTCGGACCGAGACCCCCGCTTAACTGTCAACTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCGCG
GCGGACCATCCGTATACCGATGGTCAGACAGAGCGCTTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCCTTTGCGCCGAGACACCGAAGCGTTGGAGCG
CCATGTTGCCACTCGTTGAGTTTGCGTTCAACAACGCCGTGCACGCCTCGACAGGCTACACACCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCC
GCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGGTTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAG
GTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGGGCGTGACGCGATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATACCAGGG
GCAGAGGCAATGTTAAAAGTTATGAGGTCGGGGACCTGGTGGTGCTTAACGCTAAGAACCTACCTACACATGCAGTGTCAGCCGTCTTCAAGACGAAGTT
GTGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAGGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAG