Description :
From Genome Similarity Track
Location :
Scaffold_6:2528335- 2530456
Transcript NameFunction/comments
Physo_337047Protein CBG26722

Sequence
2121 bases(100 bases per row)
CCAGTACTCATTCTCTAAGGTTGATCTCTTGTTCTTATTGACTAATCTAAGATAATCTTGTGGCTCCCAGGAGTCAAGTTCATTACCGACCCACTGAACG
AGATACTTGGACTTGCCGGATCGCATCTTTTTGTGGTCTAAGATCTTCTCCACCTCTAAAATATCACCTCTGTTGATAGTAGCTTCAGATGTTTCTGCTT
TAACAATTTTTAGATCGTTTGGCCCCTTGTAAAGAGTGTGTCCGTTTTTTGACTTGATTTGGATGCGGTAGCCATCAATACCTACCACCGAATACACAGC
CTTAGACCATCTTGCTGCTTCTTTATCAAATGTTTTCTTTTTTAGTCGATACAAAACCTTTTCACCGACCTCGAACTCGTTTTCAATCCTCTCGGCTTCA
GCCTGGTTGTGGACTAGTTCAGATTCAATTACCTTACCTTTAGCTTCGTTGGGGGTCATACCAATCGTCCGATGGGTCGTGCTATTGTAGTTGTCAATAA
CAGCAGCTATGAGCTTTTGGGTTAGTCGCTTTGGTTCGATTTTGACAAGGCGCTGCTTCAGAGTTCTATTGAAGCGTTCAATTTTACCCATTTCGGCGTG
ATCTCCAGGCTCATTGTTGAAATGGTCAATTTTCTTAGCTTTGAATAATTTCTGAACCTGTTGGTTCATGAATTCTAAACCATTATCGGTTGTGAGAATG
TCAACCTTATGGAGGCGGATAAAAACCCTAATTGCTGCTAGTACGGTCGGGCCAGTTTTGTTGGTTAGTAGTTTTGCGTAGCCTAGGCGAGAGTTGATGT
TGATCGCAGTCAAGATTGGTCTTTTCTCCCAAAACGCCAAGTCCATCTGCCACGAATTGGGGTTAGTCGATGCGATTTTGAACCCATCGTATCGCATCTT
CTGCTCCTGAAATCGCTGAATATCGCTCTGGTTTGAGTACCATTCCTTGACGATTTCATCGTAATCTTCGGCTCCAGTTCTTTAGCCTTCTGGTATAAGG
CTTGGGCACCCACATAGCCCGTTGTGGGGTCATAGTATAATTTGGACAACAGCTGATCCATCGCTCTATATGGTTATAAAACAAAAAAATCCCCTGCCAG
GTAGTTGCTTATATGTCGAGCGGTTCGGTGGTGATACCATCCGCAAGTACACGACGCTTGTCATAATAGTAGTTTAGAGCTGTTTTAGTCTGGGTGTACG
TAATGATTGACTTACTCTCCTTACTGAGTCTAAACCCCTTGTTGGTGCCCTGTAGCGTGATGCGATCGCGAACAACTGATTCAAAGCCATCTGGGTTGAG
GACGTCGCGATTCCGGCCATCACTCTGCTGGACTCCCTTCGCTGAAACCTTGACCTTGTAAGATTCGTCTGGTAGGTAGCAAATGTAGTTCTTAGAGGAC
AATGATACCATAGCATCACCAGACCACTCATCCTTGAACAAACCTGGCGTTCGGCGATCAAACTGAGCCATCTCTTCGCTATAATCACGTGGGAACCACT
CGTACTTATGCTGCTGAAAATGCTCACGAAGATCGGGCTTGATACACTCAACGAATGGCTTCTCACAGCTGAACGCAATATAAGCCGAGTCTGTGTCCAT
TTCTTGGTACTGGAATTCCGAACGGTCGAAGTAGAAGTCAATGCAATCATAGTAGAATTGCAACATACGGAGCTTAGCGAGCTGATAGATTGCAATCGAT
AGATGAATTGGGTTCTTATTGTTGAGCTTTCGCTTCTTCATAGTGAATTCACATGAATCATTCAGCTCTTCCATTCCATGGAAGGTGAAGTGCTCAATCT
TGGCCTTGATTGCCTTATCGTCCGACTCATACCTGACCTCCTTGTGCTTGCTCATGTCCATGCCAGATCGTCCAAACGCACTATTACCATCCAGTTTCAT
CATCTCTGCAATCATAGCCTTATTATTGCTACCCTCACTAAGCGTTTTCAGCTTAGTCAACAAGTCTAGAACCAAATGAATCTTAGGATTGGTTGTCGAT
TCATTCATGAATCTATCGATAATGAGCGCATCAAATGATTTAGGGTTCATAATGATTTTTTTCAACTCTTGGACTAAATCATCCATATCAGAGTCAGATA
CCTTCTCAATAATGATCTTAC