Description :
From Genome Similarity Track
Location :
contig_55:252800- 255159
Sequence
2359 bases(100 bases per row)
CATCGACTGTCGTTTTGGCAGGCGTTCGGGTTCCTTGGACTCCCCATGCTGGTATTCCTTGTCTTTTCCATTGCTTGGACGGGGTGGTTAATTATCATGA
CCCTCGCACCCAATGAGACCGCAAACTACCTTATGAACACTGGCGAGTACGACGGTGGACAGTTCTGGTTGCTCGTGGAGCAAGACAAAGGCATGAAGTT
CGTCAGAATTCTTGGGCTCATGTTGGCCGAGGTTGGCTACTTTCATATTTTGGCGAAAATGCTGGTGTGGCGTACGGTCCCAGCACCATTTGCTGGGAAA
GCAGGAAAGTTGCGAAAGGCCAGTATCGAAAAGAAAGGAGTGCCCCAGCCGCGACCAAAGCTCACCCCCAGAGAGTTTTTGCAGGAGCTGACAGGGATCA
ACGGATCATTTCGCAAATACTGGGTAAGTACATGCCTTTTCATCACACTTACAACAATCTAACGGGTTACTCCACAGAATGTAGTGCACAAATTAGCAGA
CCTGACTACGCAAGCAGTTTTACTGAACAATTATCTTGAGAAAGGCTTTCCAGTTCCATTGGTTTATGGATGGACCATGTTCATCAGTATGAACTGCTTG
TCGTGCGTGCATAGCATCTTGATGAACAAGCATTCTGCTTTAGCCGAGATTCTGCTCGACTCGATGTACGTAAATTGTCTACGGGAATGGGAAGATTTTG
CAGGGTTAACCTTGCGTTTGGTCGGACAGGTTTGACCTCGTCGCCACAATTGTATACCCCATGGTTGTGCTCATTTACTGCTATCACAACTTCGTGTTCG
ATCACGCCGTATTCCGGACTTACATGCAGGTATTGCCTCCTGGGAGTTTCGAGATCATCGCTCGTTTATTTGCCGACCCAGCGCAAGTGGAACTCTTTCG
AGTGAACTTCAATTCTCTTCGAGACGAAACGCCGTTGCTTCTACTTATTCATCTGTTGATGAACTTATCTTTTGGCATCGCTTCAGGGGAGTCATCGAAG
TGATGTTGAAATCCAATCGCCGCCTAGTTTACCCCAGGCGACACACTAACTTCCACGCTCGACTTCAAAAAAGGGTACCGAAACCATGCGCCGTGTTCTT
TATACTTGCCAGTGCACTGGTGGTGCCGTATGCTCACTATGCAATCGAAGCATCACGGACAACATGTAGCCCATACGCGGAGTGTATGGTATACGCTTAT
CGTTCTCCATGGATTTCTGCAAGCCGTGACGTTTGTCCCTGTCGGACTCTAGTTGACATCGACAAGGCTCCCAAAACATTTGACGAGTGGATTAATCCCA
TCGATGTCACAGAGAAAGTGAAAACGCTCTCTGCCTCTGGTGATCTCAAAGTACTTCGGCTGATGAACCGACAGTTGTTAGAGCTGCCAATCGAGCTGCA
GAATTGCCAACTCGAACACTTGTAAGTCAACAATAAAATGCATAAATCTGCGATCATCTAACCTCAACATCTCTGTTTTGCCCCCAGGTCTCTTATTTAC
ACGTCGATCACCTCTTTTCCAGATTGGACAAAGCACTGGGACTCACTCGAATTCCTGTACGAACGGTGATAGAGGGAGGATCTGTCACAACAAAACCAGT
CTAACAATGACTTCTCTTTTGCAGACACGTGGAGGGAAAGCAAGGAAGCGAAAATCTGGCGTATCTACCGAGCGATTTGTTCAGCAATATGCCGGATCTA
GTGTTTCTCCACTTCGCATTACACAAAACCCTGAAAAAGCTACCGGCACTACTCGGAACACCGAAGCTGAAGACATTAGAAGTTGCTCATCTATTTGGTC
TGACGAAGCTTCCTGACCTGGACAAGACCTTGGATTTGAGAGGCATCGTGATCGCATATCTTCCTCTACTCGAGACACTACCAGAGCTGCTGCACCTAAA
ATACTTGACCAGCTTGACTGTTTTTCGCCCAAGCTTCCTGTGCTGCAACGGATATCTTGGACCGTGTGATTTGACCCATCCGTTCTGCGAGGCGGACCGA
ATACATGGCTTTCCTGCTGCTGCGTGTTTGACCGATGATAAGGTTCGAGCAAGCTCGGCGATGGTGAAGTTTCTCCAAGGTTTTGGTCCGGCAGTTTGCT
TCAAGACGCCAGACGACCTCCTTGAATTTGCAGACATCCCAACGAAAACTTCAGTGGATATGTGCGATGGCGTTCCCTATCGACGTTGTGAGATTATTGA
CCCTGAACGCAGGGAGACGTTCGTAGGCATGTGCTACAACCTCCGCATGCAAGTGCTTTCGTGCAATCCGGACCCGAACTATATCACCCTTCGCAAACTT
CAAATTAGTTTGAATGTTGGCACGCCTTGCGACGTCAAGGAAGAAGCGTGGCTTGGGTG