Description :
From Genome Similarity Track
Location :
Scaffold_356:25276- 27924
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_356-abinit-gene-0.29Methylosome protein 50
Pytve_DAOMBR484maker-pve_contig_356-snap-gene-0.27Dual specificity tyrosine-phosphorylation-regulated kinase

Sequence
2648 bases(100 bases per row)
CCGGCGTTCGCGGCGCCGCTGGCGGTGGACGCGCTGGCGGCCACGTCGCTGCCGAGCGGCGCGCAATCCTCTGATGACCTGGGTAGCGCGAACGAGCTGG
ACACGGGCGCGTTCGTGGCGCCGCTGGGCGAGGACGACGCGCTGCTGGCGGCCGCCGTCTCGCGGCTCGAGGGCAACNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCGGCGTGGCGCTGCTGGACGCCGCCACGCTCGAGCAGCTCTGCCAGCTCTCGCTCAACGCCGGTGTGAGCGCGCTCGCGTGGGGCGGCGCCGACC
GCGACGTGCTCTGCTGCGGCTGCGACGACGGCGACATTGTGCTCGCGCGGCTCGCGACCGACGTCGACTTTACGTTTGTGCCGCTCGACCAGGCGGACGG
GGATGAGGACGAGCAGCGGGAGACGTGGGGACACGACGACGTCGTCACGGGCGTGTCGGCGTCGGCGGTGGAGAAGACGCAGCTTGCGTCCAGCAGCTGG
GACCTCACGTGCGGTTGATGGAAATGGACCACCTCATGACTGATGCTAATGCTAATGCTGTGGATGTGGTGAATGTGGTGGATGTGACTGCAGAGTCAAG
CTGTGGGACATTGCGGCGCGCGACAAGCTGGTTGAGACCTTCCAAGGTGCGATATCGATTCGCATTCGAGAGGCTTAAGGCTATCACTCGTTGCATTCGC
CTTCGAGGATGAAGCTATCACTAGTGTTTGACTAACTAACCTATTGCTAATGATGCCGCCGGAGCAGGACACACCGACCTCGTGTGGGGAGTCGCCATGC
ACCCGTCGACGGCGCCGCTGCTCGCGTCCGCCGGCCAGGACGGCCGCGTGCTCGTGTGGGACCGCCGCCGGCCGCAGGACGCCAGCCTCGTGCTCGCCAC
NNNNNNNNNNNNNNNNNNCGCCGGCGCTTTGCATCGACTGGCACCCGCGCAAGGACTACGTCGTCGCCGTCGGCCTCGAGGACGGCGTCGTCGCCGCCTT
CGACACGCGCGCGCCGGCCAAGCCGCTCAACACTCTGGTGCGTCTCGTCCTCTTCCAGTTGCAGCTGCAGCATCCATTTGAACTGACTGGAAATGGCCTG
ACAATGGAGCAGCACGCGCACGAGGGAGCCGCCCACGTCGTCAAGTACTCGCCGTTCCACGAGGACCTGCTGGCCTCGGGCGGCGACGACGCGCGCGTCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGAGCTGCGTCTCTGGCGCCGCGCAGCTCGCCGAGGCGTCGACGAGCCACTCC
GACTACGTGCGCGGCCTCGCCTGGTTCAACCTGCGCGACCCGCTCGCGAGCCACCGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGACGCGCACGACGGCCAGTCGCTGCTTGAGCGCGCCTTGTGAATGGACCGACCGTCTTT
TGAACCTTGTTGTATCGTGTTCCCTTTCAGTCCCTGGCCAGCCACGGGTCCAGCAGCGCCTCGTGCGGCGTGAGCCTCCGCGCCGGGTCCCACTCCAGGC
ACCGCGCGAGGAAGGCGAGGAAGGCGGCGTCGTCCGACTGCGCGGCGGCCTTGAGACTGCGGCTGTTGACCACGCGCCGCCGGCCGCGCGAGTTGACGAA
CGGCTTGGCGACGAACCCGCCGCCGTTGACCTCGTCGAAGAACTGGCGGNNNNNNNNNNNNNNNNNNNNNNNGCTTGCACTGCTCGAGGAAGGCCGCGGG
AGGCGCGCCGAGCACCTCGAGGATGCAGTGGAGCTGCTCCGTCTCGTTCTCGCCCGCGAACAGCGGGTGGCCGCCGTGCAGCTCCACGAGCACGCACGCG
AGGCTCCACATGTCGATGGGCGTCGAGTACGCGTGGCCCAGCAGCACCTCCGGGCTGCGGTAGAACCGCGACTGCACGTACGTGAACATGGCGCCGGCGG
TCGGCACGCACGCGCTGCCAAAGTCGATAAGCTTCACGTCCATCGCTTGGTCAGATCTTGTATCATATGTGACGTGTGAGCATGCGACGTGTGAGCACTC
GTCGTTTGTATCATCTGCGACGTGTGAGCAGATCAGCACGTTCTCGGGCTTGAGGTCGCAGTGCACCACGTCGAGCTCCTGCAGCGAGCGCAGCGCGAGC
ACGAGCTGGCGCGCGACGCCGCGCACGGTGCGCATCGGGAACCCCTTGAAGAACCGCAGGCGCAGCGCGTCGTACAGGTTCGGCCCGAGCAGCTCGAACA
CGAGGCACACGTGGCGCCGGAACGTGAACCGCTCGAGGAACCGGACAACATTGTGCGCATTCGAGTGCGCCACGCGCGCCAGCAGCTGCGCCTCGACTGC
CGCCTGCGCCGCGTACTTGGGCCGGTTGCGCACGATCTTGACGGCCACGCGGCGCTGCGTCGCGTGGTCCGTGCACTCGACGACCTGCCCGAACGCGCCG
CGACCCAGCGCACGCTGCACCTCGTACCGGAACGCTAAATGGTCCCCGAGCACCACGAGGTAGTCGCCCTGCGGGTCGTCAAAGCCGAAGTTCGGCAGCT
CGTGCTCCAGCGCAGCGTCCTCCAGCGCAGGGTCTTCATCCTCATCGT